Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Bern 2007 Link Collection

Protein visualization


World index of molecular visualization and modeling software

Visualization on low-end notebooks: Example RasMol

Visualization inside the browser: Example JMol

Visualization using today's graphics cards and OpenGL: Example YASARA
PyMol, Swiss PDB Viewer , VMD

Reading molecules in 100 different file formats: OpenBabel

Protein structure prediction

CASP blind prediction experiments

List of all servers for automated structure prediction

Alignments for building homology models: BLAST/PsiBLAST , GenThreader

Complete homology modeling examples: Phyre, SwissModel

Protein modeling

Similarity search: DALI