Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Building molecules with YASARA


YASARA provides extensive molecular building facilities:

  • Build atoms and entire amino acid and nucleotide residues (Figure 1).
  • Add residues to the C-terminal or 3' end, arriving at peptides and nucleic acids. The backbone dihedral angles can be specified directly to let the macromolecule adopt a certain conformation (Figure 2).
  • Build stretched-out proteins and nucleic acids directly from FASTA sequence files.
  • Exchange residues to model point mutations.
  • Add terminal oxygens to proteins.
  • Add terminal acetyl- and N-methyl capping groups to proteins.
  • De-novo building of small molecules, make chemical modifications to existing molecules. Hydrogens adapt automatically to changes.
  • Automatically correct problems like missing atoms etc.
  • Oligomerize proteins to adopt their biologically relevant quaternary structure.
  • Crystallize proteins to fill the crystallographic unit cell.



Ras effector Nore1
Figure 1: Building amino acids and nucleotides
Knowledge based potentials
Figure 2: Building peptides and nucleic acids (clockwise): alpha helix, single unpaired beta strand, left-handed alpha helix, RNA, DNA, 3-10 helix