Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Molecular dynamics

° 

Movies

To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). MacOSX tries to hide the yasara directory from you: open Finder, browse to the YASARA application and click on 'Show package contents' in the context menu to see the yasara directory.

If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros, that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.

° 

The YAMBER force field, ICMSB 2003

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Simulation and quantum mechanics of small molecules

Figure: A snapshot from the movie
This tutorial introduces fractional bond orders and pH dependency, shows how to build and simulate small molecules, and how to use quantum mechanics to optimize geometries and compare tautomers.

Written by: Elmar Krieger

License: GNU GPL, except coral reef background by Ove Hoegh-Guldberg (Centre for Marine Studies, University of Queensland)

Last modified: 2012/04/01

° 

Accurate simulations in water

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

The theory behind molecular dynamics simulations

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Interactive simulations for modeling

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Plugins

Plugins are Python scripts or Yanaconda macros that extend YASARA's user interface and get activated when you click the respective option. They are the method of choice to extend YASARA with your own functions.

All plugins are distributed together with YASARA and should be available from the graphical user interface. Windows users need to have Python from www.python.org installed.

To reinstall a plugin, just download the ZIP file and unpack it in the yasara/plg directory. If you then restart YASARA, the new options will appear in the menus. If you are not sure where the option appears, look at the top of the main plugin file (*.mcr or *.py).

° 

Sample cartesian space with CONCOORD

This plugin runs the CONCOORD program and creates an ensemble of structures that span the conformational space of the selected protein, click Edit > Sample > Object. Requires YASARA Version 4.3.13. Currently only Linux is supported. More information about CONCOORD can be found at http://www.mpibpc.gwdg.de/abteilungen/071/bgroot/concoord.html. CONCOORD is automatically downloaded from this site the first time you use the plugin. Please cite: B.L. de Groot, D.M.F. van Aalten, R.M. Scheek, A. Amadei, G. Vriend and H.J.C. Berendsen; "Prediction of protein conformational freedom from distance constraints", Proteins 29: 240-251 (1997). If the structure contains lots of bumps, this may cause convergence problems, so it is best to use only energy minimized structures.

Written by: Bert de Groot

License: GNU GPL

Last modified: 2013/01/24

° 

Color atoms by force acting on them

This plugin colors all atoms by the force acting on them. This is helpful to identify regions of conformational stress. Blue means zero force (<1000 pN), red medium force and yellow maximum force (>5000 pN). Click View > Color > All by force.

Written by: Sander Nabuurs

License: GNU GPL

Last modified: 2009/04/06

° 

Macros

Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.

° 

Analyzing a molecular dynamics trajectory

This macro analyzes a simulation and creates a table with energies and RMSDs from the starting structure, as well as the minimum energy structure and the time average structure with B-factors calculated from the root mean square fluctuations. If you want to do your own custom analysis, search for 'Example:'.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/04/19

Download: md_analyze.mcr

° 

Running an accurate molecular dynamics simulation in water

This macro sets up and runs a simulation. It can also continue a simulation that got interrupted.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/03/25

Download: md_run.mcr

° 

Convert between SIM and XTC simulation trajectories

This macro converts an existing MD trajectory between various formats. Supported are SIM->XTC, SIM->PDB, SIM->SIM, XTC->SIM and XTC->PDB.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/03/25

Download: md_convert.mcr

° 

Running a steered molecular dynamics simulation in water

This macro sets up and runs a steered simulation to pull a ligand from its binding site. As soon as they have been pulled apart completely and atoms start crossing periodic boundaries, the macro works no longer correctly

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/02/21

° 

Running a molecular dynamics simulation of a membrane protein

This macro sets up and runs a membrane simulation. It scans the protein for secondary structure elements with hydrophobic surface residues, orients it accordingly and embeds it in a membrane of adjustable lipid composition. Finally a 250 ps restrained equilibration simulation is run, which ensures that the membrane can adapt to the newly embedded protein. Then the real simulation starts.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/02/21

° 

Refining a homology model by molecular dynamics simulation in water

This macro runs a 500 ps simulation of a homology model using the protocol described in Proteins 57,678-683. It saves one PDB file every 25 picoseconds, including a table with force field energies to identify the best snapshot. In YASARA Structure, this table additionally contains Dihedrals, Packing1D and Packing3D checks (see the Check command). And in the Twinset, three more checks are included: PhiPsi, Backbone and Packing3.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/02/21

Download: md_refine.mcr

° 

Analyzing the change of secondary structure in a molecular dynamics trajectory

This macro analyzes a simulation and creates a table with per-residue secondary structure as well as a graphical plot

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/02/21

° 

Analyzing a molecular dynamics trajectory per residue

This macro analyzes a simulation and creates a table with average RMSFs and RMSDs from the starting structure per residue

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/02/21

° 

Analyzing a molecular dynamics trajectory of multiple objects

This macro analyzes a simulation and creates a table with energies and RMSDs from the starting structures for multiple objects

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/02/21

° 

Play back a molecular dynamics trajectory

This macro provides an interactive molecular dynamics trajectory player

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/08/26

Download: md_play.mcr