Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Folding proteins with a Transgenic Algorithm

Throughout the history of science, mother nature has always been a rich source of inspiration. Four billion years of a painful trial- and error process known as "evolution" provide an inexhaustible reservoir of elegant answers to a variety of difficult questions. During the development of YASARA's fold prediction module YASARA FOLD, we took a close look at the current state of life and concluded that since the first mating of eukaryotic cells (which forms the basis of the now widely used genetic algorithms), a quantum-leap occurred, that has not yet found its counterpart in fold prediction: Due to the advent of genetic engineering, the phenotype has in principle gained access to its genotype, with genome sequencing, annotation and gene therapy providing a directed feedback-loop, that heavily exceeds the possibilities of random Darwinian evolution.

YASARA FOLD has therefore been based on a transgenic algorithm that mimics nature's latest evolutionary achievement: genetic engineering. The genotypes are sets of inter-atomic distances, and the phenotypes are the corresponding three-dimensional coordinates. In addition to the usual steps takes by genetic optimization algorithms (mutation, crossover and selection), YASARA can build and modify genotypes in a rational manner, correct "bad" genes, choose "good" ones for mating or propagate "useful" abilities acquired during lifetime (i.e. molecular dynamics simulations) back to the genome (using a process called impression or reverse expression, bringing Lamarck's ideas back to life).

Click here for a more detailed description of the 10 steps to Transgenic Fold Prediction.

Click here to read the corresponding CASP4 abstract.

Click here to see the CASP4 results.