Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

About us

YASARA is brought to you by YASARA Biosciences GmbH in close collaboration with Bio-Prodict and the WHAT IF Foundation. Our aim is to advance science by providing the community with the required research tools. Since its public launch in 2003, YASARA has steadily grown to an all-in-one solution that takes the steps from protein sequence to structure to function to drug design, and is nevertheless powerful enough to handle the large amounts of data required by structural and functional genomics projects. Due to the enormous size of the problem, collaborations with other research groups are always welcome. We generally use scientific results instead of sales-departments to convince our customers. This approach saves a lot of money, which in turn allows us to offer the software for free or at realistic, non-fantasy prices (depending on the product), for academic as well as industrial environments. Any new methods used in our programs are published in peer-reviewed journals, so that you never have to rely on brochures instead of scientific facts. By obtaining software directly out of the research lab, you can be sure not to waste money on a program whose development essentially stopped five years ago - far too long in this rapidly evolving field.
If you want to contact us, just click here.


YASARA Biosciences

Bio-Prodict logo

WHAT IF Foundation




Elmar Krieger

Development of YASARA was started in 1993 by Elmar Krieger, together with his study of Molecular Biology at the University of Graz, Austria. In 1997, YASARA became the topic of his master's thesis, supervised by Prof. Günther Koraimann. In 2000, YASARA moved to the Center for Molecular and Biomolecular Informatics (CMBI) in Nijmegen, the Netherlands, where Elmar became PhD student of Prof. Gert Vriend on the right. In 2002, Elmar founded YASARA Biosciences, a company located in Austria, with the aim to develop, distribute and support YASARA. Since 2003, WHAT IF and YASARA work closely together in the Twinset, providing you, the user, with over 40 man years of protein modeling expertise at the touch of a button.


Kornel OzvoldikKornel Ozvoldik is YASARA's COO and biophysicist. He obtained his Master in Physics from the Vienna University of Technology, working on new approaches for calculating the 2-point function of the holographic dual conformal field theory to Chern-Simons gravity on a 3-dimensional Lorentzian flat space background. Since he managed to travel along this twisted path to quantum gravity without being fettered by theoretical strings, Kornel was more than qualified to dive into biophysics. He has long experience in C/C++ development, is a Pythoneer and currently working on free energy calculations and analysis of molecular dynamics simulations.


Bio-Prodict Team Bio-Prodict BV is our partner company located in Nijmegen, the Netherlands. It was founded in 2008 by Dr. Henk-Jan Joosten and has since then grown quickly to become a unique provider of knowledge in protein engineering, molecular design and DNA diagnostics. At the core of Bio-Prodict's product range are the 3DM information systems. These are protein super-family platforms that integrate many different types of protein-related data, and use YASARA for modeling and visualization. A movie that shows how this works in practice is available at the Bio-Prodict site.


Gert VriendGert Vriend started programming WHAT IF in 1987 as a PostDoc in Groningen, the Netherlands. In 1989, he moved to the EMBL in Heidelberg, joining the group of Chris Sander. From 1996 on, he led the 'Vriend group' and, together with his students, added an  uncountable number of options to the program. Since 2000, he is Professor of Bioinformatics and head of the Center for Molecular and Biomolecular Informatics (CMBI) in Nijmegen, the Netherlands. Elmar Krieger (on the left) was his first PhD student there. The WHAT IF Foundation is a non-profit organization founded in 1992, that uses revenues from WHAT IF sales to ensure further WHAT IF development and to support students.

Contact address:

YASARA Biosciences GmbH
Dr. Elmar Krieger
Wagramer Strasse 25/3/45
1220 Vienna
Austria / Europe
VAT-Number: ATU65614837

www.yasara.org
Email Elmar Krieger

Contact address:

Bio-Prodict BV
Dr. Henk-Jan Joosten
Nieuwe Marktstraat 54E
6511 AA Nijmegen
The Netherlands / Europe

www.bio-prodict.nl

Contact address:

WHAT IF Foundation / CMBI
Prof. Gert Vriend
Toernooiveld 1
6525 ED Nijmegen
The Netherlands
VAT-Number: NL003634255B02

www.cmbi.ru.nl/whatif