Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Products

There are four different stages of YASARA for Linux, Windows and Mac OS X, aimed at increasingly complicated fields of application. A certain stage contains the features of all the previous stages, plus a number of additional functions to tackle a wider range of scientific questions. Features with unique properties which you will not find in other programs are marked with orange buckyballs below.

YASARA View - Molecular graphics and analysis, freely download now .

YASARA Model - Everything above, plus molecular modeling

YASARA Dynamics - Everything above, plus molecular simulations

YASARA Structure - Everything above, plus structure prediction and validation, docking, knowledge-based potentials

YASARA NMR Module - NMR structure determination

YASARA/WHAT IF Twinset - Extensive structure validation (PDBReports) and WHAT IF functions

A stereoscopic molecular modeling lab for 250 EUR, and a cave for 800 EUR.

Read more about the philosophy behind YASARA.

Stage I: YASARA View - Free download
 

YASARA View is available for free and contains all the functions you need to explore a macromolecular structure interactively. As a bonus, you get YASARA's innovative 3D engine, which is up to 35 times faster than what you usually know from OpenGL (see benchmarks ), you can load multiple structures at the same time, create publication-quality ray-traced images including labels, and program your own macros and Python plugins. Included is YASARA Movie, a player for multimedia presentations and tutorials created with any of the higher stages, as well as the YASARA Python module to simply 'import yasara' in your Python scripts.

Key features:


Click here for free download, click here for screenshots, click here for a complete feature list .


Stage II: YASARA Model
 
YASARA Model

YASARA Model contains YASARA View and adds all the functions you need to explore, analyze and model small to macromolecules in a production environment. This includes many features you often miss: unlimited undo/redo, macro recorder, quad-buffered stereo with shutter glasses or stereoscopic screens. You can load thousands of structures at the same time, move them around independently and create multimedia presentations (YASARA Movies). These movies can be encoded as MPEGs and pasted into Powerpoint or played back with all stages of YASARA, including the free YASARA View.

Key features:

  • All the features of YASARA View listed above.
  • Fully immersive OpenGL 3D stereo graphics with sterescopic screens or shutter glasses.
  • Create the fanciest molecular animations with automatic rotations, movements, zooms, text in 3D letters, texture mapping of BMP and PNG images.
  • Encode animations in MPEG format, paste them into Powerpoint presentations.
  • Import OpenOffice Impress and Microsoft Powerpoint presentations, add molecular animations to the slides.
  • Work with thousands of structures at the same time, move them around independently.
  • Extensive coordinate manipulation: center, join, transform, oligomerize.
  • Analyze contacts, hydrogen bonds and protein secondary structure.
  • Measure distances, angles and dihedrals between groups of atoms like helices or planar side-chains.
  • Change distances, angles and dihedrals interactively.
  • Choose a default pH from 0 to 14 when assigning fractional bond orders and adding hydrogens.
  • Show and calculate Van der Waals, molecular and solvent accessible surfaces, distinguish between outer and inner surfaces, calculate volumes. Analyze and show cavities formed by these surfaces.
  • Create multiple interactive cut-planes to look inside surfaces and other objects.
  • Identify cis-peptide bonds and wrong stereoisomeres.
  • Store the results of your analysis in tables, import them in Excel.
  • Record macros or write them with a text editor.
  • Support for special input devices like SpaceBall and P5 glove (currently Linux only).
  • Unlimited undo/redo.
YASARA Model CD
YASARA Model costs 100 € / 130 $ for academic and 500 € / 650 $ for commercial use, including one year of support and updates. This price includes all operating systems except Mac OS X, shipping is included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation , click here for screenshots, click here for a complete feature list , click here for license details .

Stage III: YASARA Dynamics
 
YASARA Dynamics

YASARA Dynamics contains YASARA Model and adds support for molecular simulations. In addition to YASARA's own force fields (NOVA, YAMBER) you can use other well known MD force fields like AMBER, and run accurate all-atom MD simulations in aqueous solution with Particle Mesh Ewald longrange electrostatics at twice the speed you know from other programs. YASARA Dynamics is not a "black box" with input and output files, but shows the MD simulation in real-time on screen. You can fully interact with the scene, pull atoms or whole molecules around and finally do the type of molecular modeling that Cyrus Levinthal already pioneered back in 1966 ("..do the same type of pulling and pushing in the computer that we can do with our hands while building actual models. ", cited from an article in Scientific American).

Key features:

YASARA Dynamics CD YASARA Dynamics costs 250 € / 325 $ for academic and 2000 € / 2600 $ for commercial use, including one year of support and updates. This price includes all operating systems except Mac OS X, shipping is included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation , click here for screenshots, click here for a complete feature list , click here for license details .

Stage IV: YASARA Structure
 
YASARA Structure

YASARA Structure contains YASARA Dynamics and adds all the functions needed to predict and validate macromolecular structures, including ligand docking and highly accurate force fields with knowledge-based potentials. If you already own one of the other YASARA stages, you can upgrade easily, just contact us for a quote.

Key features:

YASARA Structure CD YASARA Structure costs 350 € / 455 $ for academic and 3000 € / 3900 $ for commercial use, including one year of support and updates. This price includes all operating systems except Mac OS X, shipping is included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation , click here for screenshots, click here for a complete feature list , click here for license details .

YASARA NMR Module
 

The YASARA NMR Module solves protein structures at the touch of a button, based on the protein sequence and distance- & dihedral-angle restraints. Input files are compatible with X-PLOR, folding and refinement are visualized in real-time on screen, allowing to identify problematic restraints. Floating assignments are supported, all the details are described here.

YASARA NMR Module The YASARA NMR Module is an add-on for YASARA Structure and costs 50 € / 65 $ for academic and 500 € / 650 $ for commercial use, including one year of support and updates. This price includes all operating systems except Mac OS X, customers in Austria have to add 20% VAT. If you do not have YASARA Structure yet, click here to order or get a quotation and click here for license details , otherwise contact us directly.

The WHAT IF / YASARA Twinset
 
Twinset

The Twinset is a customized joint-distribution of WHAT IF and YASARA Dynamics (Linux and Windows, not MacOSX) or YASARA Structure (Linux only). With over 1000 citations, WHAT IF is a widely used program for structure validation and modeling. In the Twinset, WHAT IF inherits YASARA's user interface, graphics engine, macro language, unlimited undo/redo etc, so that WHAT IF functions become easily accessible.

The Twinset is freely available for academic use and costs 1500 € / 1950 $ for unlimited commercial use per building (this fee is waived if you own a group leader license of YASARA Dynamics or Structure). In addition, you need 512MB RAM, 1GB of swap space and licenses for YASARA Dynamics or Structure and also WHAT IF . Click here for WHAT IF license details . Customers in Austria have to add 20% VAT.

To order the Twinset, just place a normal order for YASARA Dynamics or YASARA Structure and then request the Twinset upgrade from support , telling us your WHAT IF license number. If you already own YASARA, email us your YASARA serial number and WHAT IF license number.



The 3D Molecular Modeling Lab for 250 EUR
 
3D Molecular modeling lab

Stereoscopic 3D molecular modeling hardware has become easily affordable, so that entire classrooms can enjoy this unique experience. The image on the right shows the currently easiest and cheapest solution: 3D vision is provided by the stereoscopic 22" screen ZM-M220W from Zalman (now on sale for just 200 EUR at Amazon , Alternate and others), which uses lightweight, flicker-free polarized glasses to separate the images for left and right eye. It is directly supported by YASARA with any graphics card and any operating system (no expensive Quadro/FireGL cards or special video drivers are needed). You can move your molecules through 3D space using the Connexion 3D SpaceNavigator with six degrees of freedom. Order now for 50 EUR.
Notes: The ZM-M220W has a resolution of 1680x1050 pixels. The polarized glasses ensure that the left eye sees only the odd pixel lines, while the right eye sees the even lines. So the resolution is reduced to 1680x525 pixels per eye as soon as the glasses are put on. This is hardly noticeable when looking at molecules, but becomes apparent when looking at characters. Text is therefore harder to read than with alternative, more expensive stereo solutions. Without glasses, the screen behaves just like any other screen and can be used for everyday work. It has a quite glossy surface, reflections can be a problem in bright rooms, but are hardly noticeable in somewhat darker 'molecular modeling caves'. At least YASARA Model is required.


The 3D Molecular Modeling Cave for 800 EUR
 
3D Molecular modeling cave

Recently also specialized 3D beamers , that previously cost above 10000 EUR, have finally become mainstream technology. You can now easily build your private molecular modeling showroom, projecting giant 3D views that measure several meters along the diagonal. The image on the right shows the 3D beamer PJD6221 from Viewsonic , costing around 500 EUR. The beamer projects the images for left and right eye alternatingly with 120 Hz. So you additionally need shutter glasses to separate the images, for example the nuVisionGX glasses shown here, costing around 200 EUR per pair. Cheaper alternatives exist, in principle all previous generations of shutter glasses that became obsolete with TFT screens can be brought back to life here. A second 3D beamer that has been tested with YASARA is the XD600U from Mitsubishi .
Notes: Tests have been done in Linux, where you need to add a 120Hz modeline to your xorg.conf. Other operating systems work too if they allow you to choose a 120Hz video mode in their display settings. Additionally, your graphics card must support quad buffered OpenGL stereo, a feature which is normally only available in workstation products like nVIDIA Quadro and AMD FireGL. These cards often also have a mini-DIN connector for the shutter glasses. If not, you have to connect the glasses in another way, for example using a VGA adaptor and a sync box. Note that nVIDIA recently discontinued the DDC stereo signal, which was commonly used in the past. Without mini-DIN connector and DDC signal, it is usually required to manually flip left and right image on average every second time you enter stereo mode. The XD600U beamer is brighter than the PJD6221 (4500 vs.  2700 lumen), but also more expensive (1300 vs. 500 EUR), and at 120Hz, its image is noticeably more blurred. At least YASARA Model is required to display stereo.


DTI Virtual Window
 
DTI Virtual Window

The Virtual Window is an autostereoscopic 19" LCD/TFT screen that allows you to see 3D without any additional glasses. Just press a button to switch between 3D and 2D mode. Order now from Dimension Technologies .
Notes:
The Virtual Window provides a 3D button, that activates a filter which directs the odd pixel columns to the left eye, and the even pixel columns to the right eye. So the original resolution of 1280x1024 pixels is reduced to 640x1024 pixels per eye, leading to reduced text quality, just like the Zalman screen above. Since there are no glasses, the 3D view depends on your position and inverts if the head is moved too far. The Virtual Window requires at least YASARA Model and a video card that supports quad-buffered OpenGL stereo, e.g. NVIDIA Quadro cards.


eDimensional Shutter Glasses
 
Shutter glasses

Shutter glasses are the method of choice to watch 3D at full resolution (the 3D screens above reduce the screen resolution by 50%). Your screen displays the images for left and right eye alternately, and the glasses ensure that they arrive at the intended eye. We recommend shutter glasses from eDimensional  due to their good price/performance ratio. Order your glasses now for 100$ (first wireless pair) and 50$  (each additional pair) from eDimensional . A more expensive but also more flexible alternative are Crystal Eye glasses from RealD .
Notes: Glasses require either a CRT screen, or a special 3D beamer described above. While new TFT flat screens with support for 120Hz have been introduced (e.g. from Samsung ), there are usually synchronization issues which limit their applicability to video games and Windows, but exclude scientific applications like YASARA. Your graphics card needs to support quad buffered stereo, as described in detail above. Note that these glasses may not work with recent Quadro cards, because they depend on the DDC signal, which was recently discontinued by nVIDIA in G8xGL and newer GPUs .



The Models@Home Cluster System
 
Twinset

Models@Home is a distributed computing environment that follows the spirit of the famous Seti@Home project, but is not tied to a specific application. Instead you can run all your favourite programs in parallel, without any need to modify or adapt them. The Models@Home screensaver allows to turn a heterogeneous Windows / Linux network into a uniform cluster.  At the CMBI , Models@Home is used for most protein modeling tasks, all YASARA force fields were developed with computer power provided by Models@Home. Models@Home is freely available including the source code.
Click here to download, click here for more information.