Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Products

There are four different stages of YASARA for Linux, Windows and Mac OS X, aimed at increasingly complicated fields of application. A certain stage contains the features of all the previous stages, plus a number of additional functions to tackle a wider range of scientific questions. Features with unique properties which you will not find in other programs are marked with orange buckyballs below.

YASARA View - Molecular graphics and analysis, freely download now .

YASARA Model - Everything above, plus molecular modeling

YASARA Dynamics - Everything above, plus molecular simulations

YASARA Structure - Everything above, plus structure prediction and validation, docking, knowledge-based potentials

YASARA NMR Module - NMR structure determination

YASARA/WHAT IF Twinset - Extensive structure validation (PDBReports) and WHAT IF functions

Read more about the philosophy behind YASARA.

Stage I: YASARA View - Free download
 

YASARA View is available for free and contains all the functions you need to explore a macromolecular structure interactively. As a bonus, you get YASARA's innovative 3D engine, which is up to 35 times faster than what you usually know from OpenGL (see benchmarks ), you can load multiple structures at the same time, create publication-quality ray-traced images including labels, and program your own macros and Python plugins. Included is YASARA Movie, a player for multimedia presentations and tutorials created with any of the higher stages, as well as the YASARA Python module to simply 'import yasara' in your Python scripts.

Key features:


Click here for free download, click here for screenshots, click here for a complete feature list .


Stage II: YASARA Model
 
YASARA Model

YASARA Model contains YASARA View and adds all the functions you need to explore, analyze and model small to macromolecules in a production environment. This includes many features you often miss: unlimited undo/redo, macro recorder, quad-buffered stereo with shutter glasses or the DTI virtual window . You can load up to 250 structures at the same time, move them around independently and create multimedia presentations (YASARA Movies). These movies can be encoded as MPEGs and pasted into Powerpoint or played back with all stages of YASARA, including the free YASARA View.

Key features:

  • All the features of YASARA View listed above.
  • Fully immersive OpenGL stereo with shutter glasses and nVIDIA Quadro cards (and others with support for quad-buffered stereo).
  • Create the fanciest molecular animations with automatic rotations, movements, zooms, text in 3D letters, texture mapping of BMP and PNG images.
  • Encode animations in MPEG format, paste them into Powerpoint presentations.
  • Import OpenOffice Impress and Microsoft Powerpoint presentations, add molecular animations to the slides.
  • Work with 250 structures at the same time, move them around independently.
  • Extensive coordinate manipulation: center, join, transform, oligomerize.
  • Analyze contacts, hydrogen bonds and protein secondary structure.
  • Measure distances, angles and dihedrals between groups of atoms like helices or planar side-chains.
  • Change distances, angles and dihedrals interactively.
  • Choose a default pH from 0 to 14 when assigning fractional bond orders and adding hydrogens.
  • Build atoms, residues, peptide chains, terminal caps and mutate amino acids.
  • Show and calculate Van der Waals, molecular and solvent accessible surfaces, distinguish between outer and inner surfaces, calculate volumes.
  • Identify cis-peptide bonds and wrong stereoisomeres.
  • Store the results of your analysis in tables, import them in Excel.
  • Record macros or write them with a text editor.
  • Support for special input devices like SpaceBall and P5 glove (currently Linux only).
  • Unlimited undo/redo.
YASARA Model CD
YASARA Model costs 100 € / 130 $ for academic and 500 € / 650 $ for commercial use, including one year of support and updates. This price includes all operating systems except Mac OS X, shipping is included, customers in Austria have to add 20% VAT.
Click here to order, click here for screenshots, click here for a complete feature list , click here for license details .

Stage III: YASARA Dynamics
 
YASARA Dynamics

YASARA Dynamics contains YASARA Model and adds support for molecular simulations. In addition to YASARA's own force fields (NOVA, YAMBER) you can use other well known MD force fields like AMBER, and run accurate all-atom MD simulations in aqueous solution with Particle Mesh Ewald longrange electrostatics at twice the speed you know from other programs. YASARA Dynamics is not a "black box" with input and output files, but shows the MD simulation in real-time on screen. You can fully interact with the scene, pull atoms or whole molecules around and finally do the type of molecular modeling that Cyrus Levinthal already pioneered back in 1966 ("..do the same type of pulling and pushing in the computer that we can do with our hands while building actual models. ", cited from an article in Scientific American).

Key features:

  • All features listed for YASARA View and YASARA Model above.
  • Prepare a simulation: clean proteins, predict pKas, assign protonation states, fill the simulation cell with water.
  • Ultrafast (Assembly language) molecular dynamics simulations and energy minimizations in non-periodic or periodic & triclinic crystal cells.
  • AMBER and newly developed force fields (NOVA, YAMBER) included, define your own force fields.
  • Accurate treatment of long-range electrostatic interactions with the Particle Mesh Ewald approach.
  • Parallel and reproducible simulations on multiple CPUs and CPU cores with close to ideal speedups.
  • Calculate energies, binding energies and solvation energies.
  • Manipulate a simulation interactively: pull atoms or entire molecules around, fix and free atoms, add restraints, toggle force field terms.
  • Show the electrostatic potential in the simulation cell, color surfaces accordingly.
  • Run simulations at the touch of a button even in the presence of ligands, thanks to fully automatic force field parameter assignment for the General Amber Force Field (GAFF). Semi-empirical QM point charges are calculated using either AM1BCC or AutoSMILES, a newly developed approach for hi-speed assignment of RESP charges.
  • Automatic correction of cis-peptide bonds or wrong stereoisomeres for homology model refinement.
  • Geometry optimization and analysis with semi-empirical MNDO/AM1/PM3 quantum chemistry using YAPAC, a built-in customized derivative of MOPAC.
  • Analyze trajectories for conformational changes etc.
  • Read and write trajectories in SIM or XTC format.
YASARA Dynamics CD YASARA Dynamics costs 250 € / 325 $ for academic and 2000 € / 2600 $ for commercial use, including one year of support and updates. This price includes all operating systems except Mac OS X, shipping is included, customers in Austria have to add 20% VAT.
Click here to order, click here for screenshots, click here for a complete feature list , click here for license details .

Stage IV: YASARA Structure
 
YASARA Structure

YASARA Structure finally contains all the functions needed to predict and validate macromolecular structures, including ligand docking and highly accurate force fields with knowledge-based potentials. If you already own one of the other YASARA stages, you can upgrade easily, just contact us for a quote.

Key features:

YASARA Structure CD YASARA Structure costs 350 € / 455 $ for academic and 3000 € / 3900 $ for commercial use, including one year of support and updates. This price includes all operating systems except Mac OS X, shipping is included, customers in Austria have to add 20% VAT. If you already own one of the other YASARA stages, contact us for an upgrade quote.
Click here to order , click here for screenshots, click here for a complete feature list , click here for license details .

YASARA NMR Module
 

The YASARA NMR Module solves protein structures at the touch of a button, based on the protein sequence and distance- & dihedral-angle restraints. Input files are compatible with X-PLOR, folding and refinement are visualized in real-time on screen, allowing to identify problematic restraints. Floating assignments are supported, all the details are described here.

YASARA NMR Module The YASARA NMR Module is an add-on for YASARA Structure and costs 50 € / 65 $ for academic and 500 € / 650 $ for commercial use, including one year of support and updates. This price includes all operating systems except Mac OS X, customers in Austria have to add 20% VAT. If you do not have YASARA Structure yet, click here to order and click here for license details , otherwise contact us directly.

The WHAT IF / YASARA Twinset
 
Twinset

The Twinset is a customized joint-distribution of WHAT IF and YASARA Dynamics or Structure. With over 1000 citations, WHAT IF is a widely used program for structure validation and modeling. In the Twinset, WHAT IF inherits YASARA's user interface, graphics engine, macro language, unlimited undo/redo etc, so that WHAT IF functions become easily accessible in Linux and Windows. The Twinset is not available for Mac OS X.

The Twinset is freely available for academic use and costs 1500 € / 1950 $ for unlimited commercial use per building (this fee is waived if you own a group leader license of YASARA Dynamics or Structure). In addition, you need 512MB RAM, 1GB of swap space and licenses for YASARA Dynamics or Structure and also WHAT IF. Click here for WHAT IF license details . Customers in Austria have to add 20% VAT.

To order the Twinset, just place a normal order for YASARA Dynamics and then request the Twinset upgrade from support . If you already own YASARA, email us your YASARA serial number and WHAT IF user number.


The Models@Home Cluster System
 
Twinset

Models@Home is a distributed computing environment that follows the spirit of the famous Seti@Home project, but is not tied to a specific application. Instead you can run all your favourite programs in parallel, without any need to modify or adapt them. The Models@Home screensaver allows to turn a heterogeneous Windows / Linux network into a uniform cluster.  At the CMBI , Models@Home is used for most protein modeling tasks, all YASARA force fields were developed with computer power provided by Models@Home. Models@Home is freely available including the source code.
Click here to download, click here for more information.


eDimensional Shutter Glasses
 
Shutter glasses

Shutter glasses allow you to watch your molecules in true 3D with photorealistic image quality, thanks to YASARA's optimized graphics engine. We recommend shutter glasses from eDimensional, due to their incredible price/performance ratio. Order your glasses now for 100$ (first wireless pair) and 50$  (each additional pair) from eDimensional .
Notes: We are not affiliated with eDimensional, only contact us for YASARA specific support. Glasses require a CRT screen, they do not work with LCD/TFT screens. Stereo is only available in YASARA Model or above, glasses have been tested with NVIDIA Quadro cards under Linux and Windows, but in principle any card capable of quad-buffered OpenGL stereo that transmits sync signals via the DDC should work. YASARA also functions with glasses from NUVision, which are however much more expensive and do not use the DDC sync signal (i.e. do not automatically turn off when you put another window on top of the YASARA window). They may nevertheless be more comfortable if you wear them in addition to normal glasses.


Connexion SpaceBall
 
Spaceball

The SpaceBall is a 3D input device that allows you to move and rotate molecules with six degrees of freedom: put your hand on top of the ball, then push and twist it as if you held the molecule in your hand. Operating together with a traditional mouse, the SpaceBall delivers a more efficient and balanced way to work. Find your SpaceBall at eBay or order directly from Connexion .

Notes: You need Linux and YASARA Model or above. We are not affiliated with Connexion, only contact us for YASARA specific support.


DTI Virtual Window
 
DTI Virtual Window

The Virtual Window is an autostereoscopic LCD/TFT screen that allows you to see 3D without any additional glasses. Just press a button to turn it back into a normal 2D screen. Order now for 1700$ (15", 1024x768 pixels, 65K colors) and 3500$ (17", 1280x1024 pixels, 16.7M colors) from Dimension Technologies .
Notes:
The Virtual Window is the ideal choice if you do not have space on your desk for a CRT screen or if you work in a room too bright for shutter glasses. The screen works a bit like the grooved stereo images one often encounters, so you have to keep your head at the right spot to see 3D. The Virtual Window has been tested with NVIDIA Quadro cards under Linux and Windows. Any card capable of quad-buffered OpenGL stereo should work. We are not affiliated with DTI, only contact us for YASARA specific support.