Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Products

There are four different stages of YASARA for Linux, Windows, Mac OS X and Android, aimed at increasingly complicated fields of application. A certain stage contains the features of all the previous stages, plus a number of additional functions to tackle a wider range of scientific questions. Features with unique properties which you will not find in other programs are marked with orange buckyballs below.

YASARA View - Molecular graphics and analysis, freely download now.

YASARA Model - Everything above, plus molecular modeling

YASARA Dynamics - Everything above, plus molecular simulations

YASARA Structure - Everything above, plus structure prediction and validation, docking, knowledge-based potentials

YASARA NMR Module - NMR structure determination

YASARA/WHAT IF Twinset - Extensive structure validation (PDBReports) and WHAT IF functions

Android tablets and smartphones that can run interactive MD simulations starting at 175 EUR.

A stereoscopic molecular modeling lab for 250 EUR, and a cave for 700 EUR.

Read more about the philosophy behind YASARA.

System requirements: None, please download the free YASARA View to verify that YASARA runs on your computer (and please contact us if you encounter problems).

Stage I: YASARA View - Free download
 

YASARA View is available for free and contains all the functions you need to explore a macromolecular structure interactively. As a bonus, you get YASARA's innovative 3D engine, which is up to 10 times faster than what you usually know from OpenGL (see benchmarks), you can load multiple structures at the same time, create publication-quality ray-traced images including labels, and program your own macros and Python plugins. Included is YASARA Movie, a player for multimedia presentations and tutorials created with any of the higher stages, as well as the YASARA Python module to simply 'import yasara' in your Python scripts.

Key features:


Click here for free download, click here for screenshots, click here for a complete feature list.


Stage II: YASARA Model
 
YASARA Model

YASARA Model contains YASARA View and adds all the functions you need to explore, analyze and model small to macromolecules in a production environment. This includes many features you often miss: unlimited undo/redo, macro recorder, quad-buffered stereo with shutter glasses or stereoscopic screens. You can load thousands of structures at the same time, move them around independently and create multimedia presentations (YASARA Movies). These movies can be encoded as MPEGs and pasted into Powerpoint or played back with all stages of YASARA, including the free YASARA View.

Key features:

YASARA Model CD
YASARA Model costs 110 € / 143 $ for academic and 550 € / 715 $ for commercial use, including one year of support and updates. This price includes Windows, Linux and Android, Mac OS X costs 20% extra, red/cyan stereo glasses and shipping are included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation, click here for screenshots, click here for a complete feature list, click here for license details.

Stage III: YASARA Dynamics
 
YASARA Dynamics

YASARA Dynamics contains YASARA Model and adds support for molecular simulations. In addition to YASARA's own force fields (NOVA, YAMBER) you can use other well known MD force fields like AMBER, and run accurate all-atom MD simulations in aqueous solution with Particle Mesh Ewald longrange electrostatics. YASARA Dynamics is not a "black box" with input and output files, but shows the MD simulation in real-time on screen. You can fully interact with the scene, pull atoms or whole molecules around and finally do the type of molecular modeling that Cyrus Levinthal already pioneered back in 1966 ("..do the same type of pulling and pushing in the computer that we can do with our hands while building actual models. ", cited from an article in Scientific American).

Key features:

YASARA Dynamics CD YASARA Dynamics costs 275 € / 358 $ for academic and 2200 € / 2860 $ for commercial use, including one year of support and updates. This price includes Windows, Linux and Android, Mac OS X costs 20% extra, red/cyan stereo glasses and shipping are included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation, click here for screenshots, click here for a complete feature list, click here for license details.

Stage IV: YASARA Structure
 
YASARA Structure

YASARA Structure contains YASARA Dynamics and adds all the functions needed to predict and validate macromolecular structures, including ligand docking and highly accurate force fields with knowledge-based potentials. If you already own one of the other YASARA stages, you can upgrade easily, just contact us for a quote.

Key features:

YASARA Structure CD YASARA Structure costs 375 € / 488 $ for academic and 3300 € / 4290 $ for commercial use, including one year of support and updates. This price includes Windows and Linux, Mac OS X costs 20% extra, red/cyan stereo glasses and shipping are included, customers in Austria have to add 20% VAT.
Click here to order or get a quotation, click here for screenshots, click here for a complete feature list, click here for license details.

YASARA NMR Module
 

The YASARA NMR Module solves protein structures at the touch of a button, based on the protein sequence and distance- & dihedral-angle restraints. Input files are compatible with X-PLOR, folding and refinement are visualized in real-time on screen, allowing to identify problematic restraints. Floating assignments are supported, all the details are described here.

YASARA NMR Module The YASARA NMR Module is an add-on for YASARA Structure and costs 50 € / 65 $ for academic and 500 € / 650 $ for commercial use, including one year of support and updates. This price includes Windows and Linux, Mac OS X costs 20% extra, customers in Austria have to add 20% VAT. If you do not have YASARA Structure yet, click here to order or get a quotation and click here for license details, otherwise contact us directly.

The WHAT IF / YASARA Twinset
 
Twinset

The Twinset is a customized joint-distribution of WHAT IF and YASARA Dynamics (Linux and Windows, not MacOSX) or YASARA Structure (Linux only). With over 2000 citations, WHAT IF is a widely used program for structure validation and modeling. In the Twinset, WHAT IF inherits YASARA's user interface, graphics engine, macro language, unlimited undo/redo etc, so that WHAT IF functions become easily accessible.

The Twinset is freely available for academic use and costs 1500 € / 1950 $ for unlimited commercial use per building (this fee is waived if you own a group leader license of YASARA Dynamics or Structure). In addition, you need 512MB RAM, 1GB of swap space and licenses for YASARA Dynamics or Structure and also WHAT IF. Click here for WHAT IF license details, and note that the academic WHAT IF version is now shareware. Customers in Austria have to add 20% VAT.

To order the Twinset, just place a normal order for YASARA Dynamics or YASARA Structure and then request the Twinset upgrade from support , telling us your WHAT IF license number. If you already own YASARA, email us your YASARA serial number and WHAT IF license number.


Molecular modeling on Android for 175 EUR
 
Android devices

Since April 2013, YASARA is available for selected Android smartphones and tablets, providing today's most feature-complete mobile molecular modeling environment, including interactive MD simulations. Tablet prices start at 175 EUR, two videos and all the details are available here.




The 3D Molecular Modeling Lab for 250 EUR
 
3D Molecular modeling lab

Stereoscopic 3D molecular modeling hardware has become easily affordable, so that entire classrooms can enjoy this unique experience. The image on the right shows the easiest and cheapest solution: 3D vision is provided using 'passive stereo', where the images for left and right eye are shown in odd and even pixel lines and separated using flicker-free polarized glasses. The first popular screens with this feature were the Zalman ZM-M215W, ZM-M220W and ZM-M240W, costing around 200 EUR. Unfortunately it appears that Zalman discontinued this product line, so they are now mostly available as refurbished second hand models. But there are many follow up products, googling for passive stereo odd even finds e.g. the LG D2342P, the HP 2311x, the AOC e2352Phz or the Viewsonic V3D231. The big advantage is that this type of display is directly supported by YASARA with any graphics card and any operating system (no expensive Quadro/FireGL cards or special video drivers are needed). You can move your molecules through 3D space using the Connexion 3D SpaceNavigator with six degrees of freedom. Order now for 50 EUR.
Notes: The ZM-M220W has a resolution of 1680×1050 pixels. The polarized glasses ensure that the left eye sees only the odd pixel lines, while the right eye sees the even lines. So the resolution is reduced to 1680×525 pixels per eye as soon as the glasses are put on. This is hardly noticeable when looking at molecules, but becomes apparent when looking at characters. Text is therefore harder to read than with alternative, more expensive stereo solutions. Without glasses, the screen behaves just like any other screen and can be used for everyday work. It has a quite glossy surface, reflections can be a problem in bright rooms, but are hardly noticeable in somewhat darker 'molecular modeling caves'. At least YASARA Model is required.


High Resolution 3D Modeling for 350 EUR
 
Viewsonic V3D241wm

High resolution 3D stereo with shutter glasses is the next higher level, since it does not suffer from the reduced resolution of the Zalman screens above. The probably easiest solution with the best price/performance ratio is the Viewsonic V3D241wm shown on the right. The screen with a 24"/60cm diagonal has a resolution of 1920×1080 pixels and a non-reflective surface, it is thus well suited for everyday work. It functions with every operating system and every graphics card (nVIDIA/AMD) that can display quad-buffered stereo with 100 or 120Hz at a resolution of 1920×1080 pixels. The shutter glasses are included in the 350 EUR package. A slightly more expensive but also more commonly used and more flexible solution is nVIDIA's 3D Vision system, check the guidelines here and here. Other suppliers of 3D glasses are eDimensional and RealD.
Notes: Your graphics card must have a dual-link DVI connector and support quad buffered OpenGL stereo, a feature which is normally only available in workstation products like nVIDIA Quadro and AMD FireGL. You do not need the very expensive high-end Quadros with mini-DIN stereo connector, since the shutter glasses are supplied with the screen and plug into the screen with a cable, neither emitter nor batteries are required. Only one pair of glasses can be connected, so this system is for one person only. And since the monitor does not know the difference between left and right image, you may have to swap left and right in YASARA on startup. The aspect ratio of 16:9 is very movie-like, you may have to fiddle with your desktop settings to avoid windows that are too wide to read. The screen shows very little ghosting, which becomes noticeable mainly in the bottom 5cm. At least YASARA Model is required.



The 3D Molecular Modeling Cave for 700 EUR
 
3D Molecular modeling cave

Recently also specialized 3D beamers, that previously cost above 10000 EUR, have finally become mainstream technology. You can now easily build your private molecular modeling showroom, projecting giant 3D views that measure several meters along the diagonal. The image on the right shows a 3D beamer from Viewsonic, costing around 500 EUR. The beamer projects the images for left and right eye alternatingly with 120 Hz. So you additionally need shutter glasses to separate the images, the probably best choice are glasses with DLP-link like the Viewsonic PGD-250 (~80 EUR) or the XPAND Edux3 (~80 EUR). An alternative with a less comfortable infrared emitter are the nuVisionGX glasses shown on the right (~200 EUR). Any beamer that is 3D-ready, features 'DLP-link' and supports a 120 Hz mode over VGA or DVI cable should work with YASARA, to see examples click here, then select 'Supported 3D projectors'.
Notes: Tests have been done in Linux, where you need to add a 120Hz modeline to your xorg.conf. Other operating systems work too if they allow you to choose a 120Hz video mode in their display settings. Additionally, your graphics card must support quad buffered OpenGL stereo, a feature which is normally only available in workstation products like nVIDIA Quadro and AMD FireGL. These cards often also have a mini-DIN connector for the shutter glasses, which is however not needed if you chose glasses with DLP-link (see above). The only disadvantage of DLP-link glasses is that you sometimes need to manually flip left and right image. At least YASARA Model is required to display stereo.


DTI Virtual Window
 
DTI Virtual Window

The Virtual Window is an autostereoscopic 19" LCD/TFT screen that allows you to see 3D without any additional glasses. Just press a button to switch between 3D and 2D mode. Order now from Dimension Technologies.
Notes:
The Virtual Window provides a 3D button, that activates a filter which directs the odd pixel columns to the left eye, and the even pixel columns to the right eye. So the original resolution of 1280×1024 pixels is reduced to 640×1024 pixels per eye, leading to reduced text quality, just like the Zalman screen above. Since there are no glasses, the 3D view depends on your position and inverts if the head is moved too far. The Virtual Window requires at least YASARA Model and a video card that supports quad-buffered OpenGL stereo, e.g. NVIDIA Quadro cards.



The Models@Home Cluster System
 
Twinset

Models@Home is a distributed computing environment that follows the spirit of the famous Seti@Home project, but is not tied to a specific application. Instead you can run all your favourite programs in parallel, without any need to modify or adapt them. The Models@Home screensaver allows to turn a heterogeneous Windows / Linux network into a uniform cluster.  At the CMBI , Models@Home is used for most protein modeling tasks, all YASARA force fields were developed with computer power provided by Models@Home. Models@Home is freely available including the source code.
Click here to download, click here for more information.