CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

Contact, support and mailing lists

If none of the options below fit your needs, just email us:
support email
What do you want to do?
(If you are just looking for more information about us, click here.)

Report a problem or inconvenience and get it fixed

If you encountered a problem, bug or inconvenience that annoys you, please report it here and receive an update plus up to 10 € / 12 $ for your help.

Contribute movies, plugins, macros or other source code

If you want to share your developments with other users, click here to submit them to the YASARA Repository. Of course you will be paid for your contribution, the maximum amount being equal to a life-long YASARA license (for exceptional contributions).

Upgrade your license

If you want to upgrade to a group leader license or a higher YASARA stage, please click here.

Administrate your group leader license

As a group leader, you can configure a second YASARA account for support.

Request a copy of your personal data

If there is anything you want to know or check about your YASARA license & account, click here to request a copy of all the information we have stored in our database.

Change your email address

Most of the contact options require that you enter the same email address as during your initial registration. Click here to change this address.

Request a new feature

If you are missing an essential feature, please notify us. Especially if the absence of the feature makes you reconsider using YASARA in the future.

Make personal contact

If none of the options above fit your request, click here to contact us directly.