Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


Structural Bioinformatics Tools

As long as you are not doing computationally intensive things like molecular modeling or running simulations, Python is a very convenient way of making quick progress in a short time. We are preparing the release of Python interfaces for a number of file formats that are frequently used in structural bioinformatics: PDB, DSSP, HSSP, FSSP and PDBFinder. For the moment, only PDBFinder is available. Also note that you can develop your own Python plugins for YASARA. All Python modules listed here are licensed under the GNU GPL. After downloading a module, look at the header and search for the string "__repr__" to see how it works.

YASARA Macro Interface

In addition to letting YASARA run Python scripts, you can also let Python scripts run YASARA. In this reversed case, your Python script creates a YASARA macro using the Yanaconda macro language and sends it to YASARA.
Download the Python module yasara_macro.py (requires disk.py below)

PDBFinder and PDBFinder II Interface

The PDBFinder is a quick and easy way to retrieve all relevant information from PDB files, including the sequences. The PDBFinder II includes information from multiple sequence alignments and quality checks, making it ideally suited for structure analysis and prediction.
Go to the official PDBFinder site at the CMBI.
Go to the official PDBFinderII site.
Download the Python module pdbfinder_file.py (requires disk.py below)


Disk access tools

This Python module provides convenience functions for handling files and directories that are either missing or too complicated in Python's standard os. module. Required by most other modules listed here. Download the Python module disk.py