Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

BLAST and PSI-BLAST in YASARA


BLAST search result

BLAST, the basic local alignment search tool, has become an integral part of virtually all bioinformatics research[1]. While web-servers make access to BLAST easy, its distribution and tight integration with YASARA offer a number of advantages:

  • The YASARA distribution server at the CMBI provides BLAST libraries  of SwissProt, TrEMBL and the PDB. The latter is updated weekly and augmented with quality scores from the PDBFinder2 database. So BLASTing against the PDB will not only yield PDB IDs, but also information about structural quality, and if there are multiple structures with the same sequence, the best structure will be ranked first. This concept also helps template selection in homology modeling.
  • The local BLAST libraries are updated fully automatically by YASARA.
  • The direct integration obviates the need to first obtain the sequence of a protein structure, and then copy & paste it to BLAST. Also Python scripts and Yanaconda macros benefit a lot. The following example macro runs BLAST for a given protein structure (interleukin-8), downloads the PDB files of the hits and aligns them structurally, resulting in the scene shown on the right side:
# Find and structurally align PDB entries with a 
# similar sequence

Clear
# Load Interleukin 8
dst = LoadPDB 3il8
# Get a non-redundant list of BLAST hits in the PDB:
# Evalue1, PDB ID1, molecule1, Evalue2, PDB ID2...

resultlist() = BlastObj (dst),Database=PDBnr
for i=1 to count resultlist step 3
# (Down)load the PDB file
src = LoadPDB (resultlist(i+1)),Model=1,Download=Yes
# Keep only the molecule reported by BLAST
DelMol not (resultlist(i+2)) and Obj (src)
# Make a structural alignment
AlignObj (src),(dst)
# Show result
DelRes HOH
Style Tube



R E F E R E N C E S

[1] Gapped BLAST and PSI-BLAST: a new generation of protein database search programs
Altschul SF, Madden TL, Schaeffer AA, Zhang J, Zhang Z, Miller W and Lipman DJ (1997)  Nucleic Acids Res. 25,3389-3402