CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

Elmar Kriegers Google Catcher

Elmar Krieger

Auf dieser Seite gibt's jede Menge Stichwörter, damit mich auch alle alten Freunde wiederfinden ;-):

Von hier geht's weiter mit dieser Email Adresse:Email

Elmar Krieger, St.Peter Hauptstraße 29/b, Neue-Welt-Höhe 13/b, 8042 Graz, Wagramer Strasse 25/3/45, 1220 Wien, Volksschule Eisteich, Akademisches Gymnasium Graz, Elmsoft Game Service, Amstrad CPC, Space Demo, Magic Demo, Twinblast Demo, Cyborgs, Zap't'Balls, Super Cauldron, Prehistorik II, Arnold CPC Emulator for Linux, Prehistorik Man, Stunt Race FX, Institut für Mikrobiologie, Universität Graz, YASARA Biosciences, CMBI, Center for Molecular and Biomolecular Informatics, Nijmegen, the Netherlands