Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Elmar Krieger's Google Catcher

Elmar Krieger

Auf dieser Seite gibt's jede Menge Stichwörter, damit mich auch jeder gleich googlen kann.

Von hier geht's weiter mit dieser Email Adresse:Email

Elmar Krieger, St.Peter Hauptstraße 29/b, 8042 Graz, Neue-Welt-Höhe 13/b, 8042 Graz, Volksschule Eisteich, Akademisches Gymnasium Graz, Elmsoft Game Service, Amstrad CPC, Space Demo, Magic Demo, Twinblast Demo, Cyborgs, Zap't'Balls, Super Cauldron, Prehistorik II, Prehistorik Man, Stunt Race FX, Institut für Mikrobiologie, Universität Graz, YASARA, Barbara Knappe, CMBI, Center for Molecular and Biomolecular Informatics, Nijmegen