Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Ion site prediction in YASARA


Calcium site prediction

YASARA Structure can predict binding sites for metal ions in protein structures and other molecules. The approach works by putting a fine grid over the protein and summing up the binding contribution of surrounding oxygen atoms at each grid point, considering ion specific parameters[1,2]. Grid points that exceed a certain threshold are shown in green (weak binding) to white (very strong binding).

The example on the right side shows predicted Ca ++ binding sites in PDB file 2F3Y (Calmodulin). Four Ca++ sites are found, marked with yellow arrows. These match the actual calcium binding sites exactly (shown below).

The approach works best with divalent ions like Ca ++ or Mg++, which exhibit a stronger signal than monovalent ions like K + [3]. The potential involvement of nitrogen and sulfur atoms (histidine, cysteine) is not considered yet.

R E F E R E N C E S
[1] Empirical parameters for calculating cation- oxygen bond valence
Brown ID, and Wu KK (1976) Acta Crystallogr. Sect. B Struct. Sci. 32,1957–1959
[2] Predicting Ca(2+)-binding sites in proteins.
Nayal M and Di Cera E (1994) Proc. Natl. Acad. Sci. U.S.A. 91 ,817–821
[3] A Conformation-specific interhelical salt bridge in the K+ binding site of gastric H,K-ATPase Koenderink JB, Swarts HGP, Willems PHGM, Krieger E and De Pont JJHHM (2004) J. Biol. Chem. 16,16417-16424