CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

YASARA License Fees

The YASARA license combines the best of 'open' and 'closed source' worlds: charging for YASARA allows us to provide you with the fast and effective support required in a production environment and to ensure further developments. Making YASARA 'open source' and charging for support only is not an option, because this creates an evolutionary pressure towards a program that requires a lot of support - which is against your interests. However, all YASARA add-ons (plugins, macros, movies) are licensed under the GNU GPL , so that you can freely share your work with others.

Multiuser licenses: if you want to install YASARA on your PC and on your notebook, that is fine as long as you are the only one to use it. If YASARA is used on more than one PC and by more than one person, you need to purchase a multiuser license. There are three options:

  • Group leader license:  this license costs twice the amount of a single license and allows to install YASARA on an unlimited number of computers belonging to one research group at a single location. Two email addresses can be registered for support: one for the group leader and one for the other group members.
  • Multiple licenses: buying multiple licenses for N users allows you to register N different email addresses for support. Use this license if several independent scientists in one university or company want to work with YASARA. Only the first master license comes with CD and booklet, the others are for download only, unless you purchase an extra CD+booklet for 20 € / 22 $. After the initial purchase, each license is treated independently.
  • Multiple group leader licenses: if multiple research groups in one university or company want to use YASARA (possibly at different locations), this is the license of choice. With N group leader licenses, you can register 2*N email addresses for support and updates. Only the first master license comes with CD and booklet, the others are for download only, unless you purchase an extra CD+booklet for 20 Euros. After the initial purchase, each group leader license is treated independently.
  • Unlimited licenses: for all research groups at a university or pharmaceutical company, possibly at different geographic locations, with discounted update and support extensions. Please contact us for details.

Academic and commercial licenses: the price of the academic license is heavily subsidized to promote free and open research at academic institutions. If  you want to carry out research with commercial interests, you need a commercial license.  This includes academic institutions engaged in patent applications and extensive collaborations with pharmaceutical companies.

Webserver licenses: if you want to install YASARA as part of a web-server so that it can be used freely by everyone, please contact us for license details.

License renewal: YASARA licenses are issued for a certain time period. If you do not renew your license, you lose access to updates and support. Academic and perpetual commercial YASARA licenses will continue to work as usual after the support ended (if you downloaded an update after your payment arrived), normal commercial versions will slow down and show a splash screen. However, you will still be able to use all the functions (e.g. to access data stored in a YASARA specific format and convert it). Please contact us for more details on perpetual commercial licenses. If you let your license expire and want to have YASARA support and updates again some time later, you need to buy a new license (but you get at least a 25% discount  if you tell us).

License changes: You can increase your YASARA license at any time (e.g. from YASARA Dynamics to YASARA Structure, from single user to group leader etc.). You will be charged with the price difference, but the elapsed time of your license will be taken into account. Request an upgrade here.

Renewal price guarantee: we guarantee that the annual cost of your first license renewal will be <=37.5% of the initial cost in the first year. If you renew your license right now (i.e. select a license period longer than one year), each additional year costs only 27.5% of the first year.

Shipping: is free of charge.

License Fee Calculator

YASARA stage:
Type of usage:
Number of licenses:
Use '1' above for one single license or one group leader license.
License period in years:

License fee formula: the calculator above uses the following formula to obtain the total cost of YASARA from the number of licenses N. For group leader licenses, 'GroupLeaderLicense' is 1, and 0 otherwise:

 TotalPrice = SinglePrice *(1+GroupLeaderLicense)* (2+0.15*(N-1)-exp(-0.63*(N-1)))*(1+0.275*(Years-1))