Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA's cross-platform features

Obtaining YASARA is truly simple: only 3 clicks are needed to download, install and run YASARA. You can also move the 'yasara' folder to a different place on your hard disk and run from there, or simply delete it to uninstall. Or copy it to a USB stick and create your own mobile molecular modeling laboratory - you can then even run YASARA from the USB stick directly, no matter if you plug it into a computer running Windows, Linux or MacOSX: YASARA simply adapts the look of its user interface (see below), but otherwise all functions remain where you expect them.

YASARA for Windows Vista


YASARA for Linux


YASARA for MacOSX


YASARA for Windows XP


YASARA for Windows 2000/ME/98/95