Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA in press

Please also notify us in case you use YASARA yourself and have a paper to be added here, which mentions YASARA. To find PDB structures determined with the help of YASARA, search for "PDB ID".



A cell-permeable inhibitor to trap g-alpha-q proteins in the empty pocket conformation.
Schmitz AL, Schrage R, Gaffal E, Charpentier TH, Wiest J, Hiltensperger G, Morschel J, Hennen S, Haeussler D, Horn V, Wenzel D, Grundmann M, Buellesbach KM, Schroeder R, Brewitz HH, Schmidt J, Gomeza J, Gales C, Fleischmann BK, Tueting T, Imhof D, Tietze D, Guetschow M, Holzgrabe U, Sondek J, Harden TK, Mohr K, Kostenis E.
Chem Biol. 2014 Jul 17;21(7):890-902. doi: 10.1016/j.chembiol.2014.06.003.
Refined Mapping of a Hypertension Susceptibility Locus on Rat Chromosome 12.
Prisco SZ, Prokop JW, Sarkis AB, Yeo NC, Hoffman MJ, Hansen CC, Jacob HJ, Flister MJ, Lazar J.
Hypertension. 2014 Jul 7. pii: HYPERTENSIONAHA.114.03550. [Epub ahead of print]
Computational development of rubromycin-based lead compounds for HIV-1 reverse transcriptase inhibition
Bernardo CEP, Silva PJ
PeerJ 2014 2:e470
Novel kv7.1-phosphatidylinositol 4,5-bisphosphate interaction sites uncovered by charge neutralization scanning.
Eckey K, Wrobel E, Strutz-Seebohm N, Pott L, Schmitt N, Seebohm G.
J Biol Chem. 2014 Aug 15;289(33):22749-58. doi: 10.1074/jbc.M114.589796. Epub
Molecular evolution of GPCRs: Melanocortin/melanocortin receptors.
Dores RM, Londraville RL, Prokop J, Davis P, Dewey N, Lesinski N.
J Mol Endocrinol. 2014 Jun;52(3):T29-42. doi: 10.1530/JME-14-0050.
Discovery of the elusive leptin in birds: identification of several 'missing links' in the evolution of leptin and its receptor.
Prokop JW, Schmidt C, Gasper D, Duff RJ, Milsted A, Ohkubo T, Ball HC, Shawkey MD, Mays HL Jr, Cogburn LA, Londraville RL.
PLoS One. 2014 Mar 24;9(3):e92751. doi: 10.1371/journal.pone.0092751. eCollection
LIMD2 is a small LIM-only protein overexpressed in metastatic lesions that regulates cell motility and tumor progression by directly binding to and activating the integrin-linked kinase.
Peng H, Talebzadeh-Farrooji M, Osborne MJ, Prokop JW, McDonald PC, Karar J, Hou Z, He M, Kebebew E, Orntoft T, Herlyn M, Caton AJ, Fredericks W, Malkowicz B, Paterno CS, Carolin AS, Speicher DW, Skordalakes E, Huang Q, Dedhar S, Borden KL, Rauscher FJ 3rd.
Cancer Res. 2014 Mar 1;74(5):1390-403. doi: 10.1158/0008-5472.CAN-13-1275.
Structural and functional insights into the catalytic inactivity of the major fraction of buffalo milk xanthine oxidoreductase.
Gadave KS, Panda S, Singh S, Kalra S, Malakar D, Mohanty AK, Kaushik JK.
PLoS One. 2014 Jan 31;9(1):e87618
Blocking CD40-TRAF6 signaling is a therapeutic target in obesity-associated insulin resistance.
Chatzigeorgiou A, Seijkens T, Zarzycka B, Engel D, Poggi M, van den Berg S, van den Berg S, Soehnlein O, Winkels H, Beckers L, Lievens D, Driessen A, Kusters P, Biessen E, Garcia-Martin R, Klotzsche-von Ameln A, Gijbels M, Noelle R, Boon L, Hackeng T, Schulte KM, Xu A, Vriend G, Nabuurs S, Chung KJ, Willems van Dijk K, Rensen PC, Gerdes N, de Winther M, Block NL, Schally AV, Weber C, Bornstein SR, Nicolaes G, Chavakis T, Lutgens E.
Proc Natl Acad Sci U S A. 2014 Feb 18;111(7):2686-91. doi:
Structural basis of PI(4,5)P2-dependent regulation of GluA1 by phosphatidylinositol-5-phosphate 4-kinase, type II, alpha (PIP5K2A).
Seebohm G, Wrobel E, Pusch M, Dicks M, Terhag J, Matschke V, Rothenberg I, Ursu ON, Hertel F, Pott L, Lang F, Schulze-Bahr E, Hollmann M, Stoll R, Strutz-Seebohm N.
Pflugers Arch. 2014 Jan 5.
Genetic variation in the two-pore domain potassium channel, TASK-1, may contribute to an atrial substrate for arrhythmogenesis.
Liang B, Soka M, Christensen AH, Olesen MS, Larsen AP, Knop FK, Wang F, Nielsen JB, Andersen MN, Humphreys D, Mann SA, Huttner IG, Vandenberg JI, Svendsen JH, Haunso S, Preiss T, Seebohm G, Olesen SP, Schmitt N, Fatkin D.
J Mol Cell Cardiol. 2014 Feb;67:69-76
A complex partnership: KCNQ1 and KCNE1.
Seebohm G.
Biophys J. 2013 Dec 3;105(11):2437-8.
Severe congenital factor XIII deficiency caused by novel W187X and G273V mutations in the F13A gene; diagnosis and classification according to the ISTH/SSC guidelines.
Souri M, Biswas A, Misawa M, Omura H, Ichinose A.
Haemophilia. 2014 Mar;20(2):255-62
Analysis of Sry duplications on the Rattus norvegicus Y-chromosome.
Prokop JW, Underwood AC, Turner ME, Miller N, Pietrzak D, Scott S, Smith C, Milsted A.
BMC Genomics. 2013 Nov 14;14:792. doi: 10.1186/1471-2164-14-792.
Favorable adsorption of capped amino acids on graphene substrate driven by desolvation effect.
Dragneva N, Floriano WB, Stauffer D, Mawhinney RC, Fanchini G, Rubel O.
J Chem Phys. 2013 Nov 7;139(17):174711
Inhibition of CIN85-mediated invasion by a novel SH3 domain binding motif in the lysyl oxidase propeptide.
Sato S, Zhao Y, Imai M, Simister PC, Feller SM, Trackman PC, Kirsch KH, Sonenshein GE.
PLoS One. 2013 Oct 22;8(10):e77288. doi: 10.1371/journal.pone.0077288.
CSF1R mutations in hereditary diffuse leukoencephalopathy with spheroids are loss of function.
Pridans C, Sauter KA, Baer K, Kissel H, Hume DA.
Sci Rep. 2013 Oct 22;3:3013. doi: 10.1038/srep03013.
MAS promoter regulation: a role for Sry and tyrosine nitration of the KRAB domain of ZNF274 as a feedback mechanism.
Prokop JW, Rauscher FJ 3rd, Peng H, Liu Y, Araujo FC, Watanabe I, Reis FM, Milsted A.
Clin Sci (Lond). 2014 May;126(10):727-38. doi: 10.1042/CS20130385.
Engineering and kinetic stabilization of the therapeutic enzyme Anabeana variabilis phenylalanine ammonia lyase.
Jaliani HZ, Farajnia S, Mohammadi SA, Barzegar A, Talebi S.
Appl Biochem Biotechnol. 2013 Dec;171(7):1805-18
Human VKORC1 mutations cause variable degrees of 4-hydroxycoumarin resistance and affect putative warfarin binding interfaces.
Czogalla KJ, Biswas A, Wendeln AC, Westhofen P, Mueller CR, Watzka M, Oldenburg J.
Blood. 2013 Oct 10;122(15):2743-50
The preferred conformation of dipeptides in the context of biosynthesis.
Bywater RP, Veryazov V.
Naturwissenschaften. 2013 Sep;100(9):853-9
The linker pivot in Ci-VSP: the key to unlock catalysis.
Hobiger K, Utesch T, Mroginski MA, Seebohm G, Friedrich T.
PLoS One. 2013 Jul 29;8(7):e70272
The good, the bad and the dubious: VHELIBS, a validation helper for ligands and binding sites.
Cereto-Massague A, Ojeda MJ, Joosten RP, Valls C, Mulero M, Salvado MJ, Arola-Arnal A, Arola L, Garcia-Vallve S, Pujadas G.
J Cheminform. 2013 Jul 29;5(1):36
A common structural component for beta-subunit mediated modulation of slow inactivation in different KV channels.
Strutz-Seebohm N, Henrion U, Schmitt N, Schulze-Bahr E, Seebohm G.
Cell Physiol Biochem. 2013;31(6):968-80
Redesign of a Phenylalanine Aminomutase into a Phenylalanine Ammonia Lyase
Bartsch S, Wybenga GG, Jansen M, Heberling MM, Wu B, Dijkstra BW, Janssen DB
ChemCatChem 5,1797-1802
A plant homolog of animal glutamate receptors is an ion channel gated by multiple hydrophobic amino acids.
Tapken D, Anschuetz U, Liu LH, Huelsken T, Seebohm G, Becker D, Hollmann M.
Sci Signal. 2013 Jun 11;6(279):ra47
Differential mechanisms of activation of the Ang peptide receptors AT1, AT2, and MAS: using in silico techniques to differentiate the three receptors.
Prokop JW, Santos RA, Milsted A.
PLoS One. 2013 Jun 3;8(6):e65307. doi: 10.1371/journal.pone.0065307. Print 2013.
A method for in silico identification of SNAIL/SLUG DNA binding potentials to the E-box sequence using molecular dynamics and evolutionary conserved amino acids.
Prokop JW, Liu Y, Milsted A, Peng H, Rauscher FJ 3rd.
J Mol Model. 2013 Sep;19(9):3463-9. doi: 10.1007/s00894-013-1876-y. Epub 2013 May
Insights into pathological mechanisms of missense mutations in C-Terminal domains of von Willebrand factor causing qualitative or quantitative von Willebrand disease
Yadegari H, Driesen J, Pavlova A, Biswas A, Ivaskevicius V, Klamroth R, Oldenburg J
Haematologica. 2013 Mar 28
A conserved threonine in the S1-S2 loop of K(V)7.2 and K (V)7.3 channels regulates voltage-dependent activation.
Fuell Y, Seebohm G, Lerche H, Maljevic S.
Pflugers Arch. 2012 Dec 28.
NMR structure of a lytic polysaccharide monooxygenase provides insight into copper binding, protein dynamics, and substrate interactions
Aachmann FL, Sorlie M, Skjak-Braek G, Eijsink VG, Vaaje-Kolstad G
Proc Natl Acad Sci U S A. 2012 Nov 13;109(46):18779-84
An NMR structure determined with the help of YASARA, PDB ID 2LHS
Eurocin, a new fungal defensin: structure, lipid binding, and its mode of action
Oeemig JS, Lynggaard C, Knudsen DH, Hansen FT, Norgaard KD, Schneider T, Vad BS, Sandvang DH, Nielsen LA, Neve S, Kristensen HH, Sahl HG, Otzen DE, Wimmer R
J Biol Chem. 2012 Dec 7;287(50):42361-72
An NMR structure determined with the help of YASARA, PDB ID 2LT8
Leptin and leptin receptor: analysis of a structure to function relationship in interaction and evolution from humans to fish.
Prokop JW, Duff RJ, Ball HC, Copeland DL, Londraville RL.
Peptides. 2012 Dec;38(2):326-36. doi: 10.1016/j.peptides.2012.10.002. Epub 2012
Post-translational S-nitrosylation is an endogenous factor fine tuning the properties of human S100A1 protein
LenarcicčZivkovi M, Zareba-Koziol M, Zhukova L, Poznanski J, Zhukov I, Wyslouch-Cieszynska A
J Biol Chem. 2012 Nov 23;287(48):40457-70
An NMR structure determined with the help of YASARA, PDB ID 2LLU
Structural rearrangements at physiological pH: nuclear magnetic resonance insights from the V210I human prion protein mutant
Biljan I, Ilc G, Giachin G, Plavec J, Legname G
Biochemistry. 2012 Sep 25;51(38):7465-74
An NMR structure determined with the help of YASARA, PDB ID 2LV1
The KCNE Tango - How KCNE1 Interacts with Kv7.1.
Wrobel E, Tapken D, Seebohm G.
Front Pharmacol. 2012;3:142. Epub 2012 Aug 2.
Protein folding: a problem with multiple solutions.
Bywater RP.
J Biomol Struct Dyn. 2013 Apr;31(4):351-62
Accelerated simulation of unfolding and refolding of a large single chain globular protein.
Seddon GM, Bywater RP.
Open Biol. 2012 Jul;2(7):120087
Inactivation and reactivation of ribonuclease A studied by computer simulation.
Seddon GM, Bywater RP.
Open Biol. 2012 Jul;2(7):120088
NMR structure note: solution structure of Ca2+ binding domain 2B of the third isoform of the Na+/Ca2+ exchanger
Breukels V, Touw WG, Vuister GW
J Biomol NMR. 2012 Sep;54(1):115-21
An NMR structure determined with the help of YASARA, PDB ID 2LT9
Motion of transfer RNA from the A/T state into the A-site using docking and simulations
Caulfield T, Devkota B
Proteins. 2012 Nov;80(11):2489-500
Structural basis for the protective effect of the human prion protein carrying the dominant-negative E219K polymorphism
Biljan I, Giachin G, Ilc G, Zhukov I, Plavec J, Legname G
Biochem J. 2012 Sep 1;446(2):243-51
An NMR structure determined with the help of YASARA, PDB IDs 2LFT and 2LSB
The Catalytic Machinery of Rhomboid Proteases: Combined MD and QM Simulation
Uritsky N, Shokhen M, Albeck A
J Chem Theory Comput
Overlapping cardiac phenotype associated with a familial mutation in the voltagesensor of the KCNQ1 channel.
Henrion U, Zumhagen S, Steinke K, Strutz-Seebohm N, Stallmeyer B, Lang F, Schulze-Bahr E, Seebohm G.
Cell Physiol Biochem. 2012;29(5-6):809-18. Epub 2012 May
Amino acid function and docking site prediction through combining disease variants, structure alignments, sequence alignments, and molecular dynamics: a study of the HMG domain.
Prokop JW, Leeper TC, Duan ZH, Milsted A.
BMC Bioinformatics. 2012 Mar 13;13 Suppl 2:S3. doi: 10.1186/1471-2105-13-S2-S3.
X-ray structures of the progesterone receptor ligand-binding domain in its agonist state reveal differing mechanisms for the mixed profiles of 11b-substituted steroids
Lusher SJ, Raaijmakers HC, Vu Pham D, Kazemier B, Bosch R, McGuire R, Azevedo R, Dechering K, Oubrie A, van Duin M, de Vlieg J
J Biol Chem. 2012 Apr 25
PDB_REDO: constructive validation, more than just looking for errors
Joosten RP, Joosten K, Murshudov GN, Perrakis A
Acta Crystallogr D Biol Crystallogr. 2012 Apr;68(Pt 4):484-96
Highly perturbed pKa values in the unfolded state of hen egg white lysozyme
Bradley J, O'Meara F, Farrell D, Nielsen JE
Biophys J. 2012 Apr 4;102(7):1636-45
Identification of a novel signaling pathway and its relevance for GluA1 recycling.
Seebohm G, Neumann S, Theiss C, Novkovic T, Hill EV, Tavare JM, Lang F, Hollmann M, Manahan-Vaughan D, Strutz-Seebohm N.
PLoS One. 2012;7(3):e33889. Epub 2012 Mar 21.
Novel Mutation in Spectrin-like Repeat 1 of Dystrophin Central Domain Causes Protein Misfolding and Mild Becker Muscular Dystrophy
Acsadi G, Moore SA, Cheron A, Delalande O, Bennett L, Kupsky W, El-Baba M, Le Rumeur E, Hubert JF
J Biol Chem. 2012 May 25;287(22):18153-62
Structurally diverse y-conotoxin PIIIA isomers block sodium channel NaV 1.4
Tietze AA, Tietze D, Ohlenschlaeger O, Leipold E, Ullrich F, Kuehl T, Mischo A, Buntkowsky G, Goerlach M, Heinemann SH, Imhof D
Angew Chem Int Ed Engl. 2012 Apr 23;51(17):4058-61
Goodpasture antigen-binding protein/ceramide transporter binds to human serum amyloid P-component and is present in brain amyloid plaques.
Mencarelli C, Bode GH, Losen M, Kulharia M, Molenaar PC, Veerhuis R, Steinbusch HW, De Baets MH, Nicolaes GA, Martinez-Martinez P.
J Biol Chem. 2012 Apr 27;287(18):14897-911. doi: 10.1074/jbc.M111.299545. Epub
Evolution of the voltage sensor domain of the voltage-sensitive phosphoinositide phosphatase, VSP/TPTE, suggests a role as a proton channel in eutherian mammals
Sutton KA, Jungnickel MK, Jovine L, Florman HM.
Mol Biol Evol. 2012 Mar 6
On dating stages in prebiotic chemical evolution.
Bywater RP.
Naturwissenschaften. 2012 Mar;99(3):167-76
The insect defensin lucifensin from Lucilia sericata
Nygaard MK, Andersen AS, Kristensen HH, Krogfelt KA, Fojan P, Wimmer R
J Biomol NMR. 2012 Mar;52(3):277-82
An NMR structure determined with the help of YASARA, PDB ID 2LLD
From rat to human: regulation of Renin-Angiotensin system genes by sry.
Prokop JW, Watanabe IK, Turner ME, Underwood AC, Martins AS, Milsted A.
Int J Hypertens. 2012;2012:724240. doi: 10.1155/2012/724240. Epub 2012 Jan 22.
Directed evolution strategies for enantiocomplementary haloalkane dehalogenases: from chemical waste to enantiopure building blocks
van Leeuwen JG, Wijma HJ, Floor RJ, van der Laan JM, Janssen DB
Chembiochem. 2012 Jan 2;13(1):137-48
Mixed inhibition of adenosine deaminase activity by 1,3-dinitrobenzene: a model for understanding cell-selective neurotoxicity in chemically-induced energy deprivation syndromes in brain
Wang Y, Liu X, Schneider B, Zverina EA, Russ K, Wijeyesakere SJ, Fierke CA, Richardson RJ, Philbert MA
Toxicol Sci. 2012 Feb;125(2):509-21
Altered stress stimulation of inward rectifier potassium channels in Andersen-Tawil syndrome.
Seebohm G, Strutz-Seebohm N, Ursu ON, Preisig-Mueller R, Zuzarte M, Hill EV,Kienitz MC, Bendahhou S, Fauler M, Tapken D, Decher N, Collins A, Jurkat-Rott K,Steinmeyer K, Lehmann-Horn F, Daut J, Tavare JM, Pott L, Bloch W, Lang F.
FASEB J. 2012 Feb;26(2):513-22. Epub 2011 Oct 14.
Homology modeling and functional annotation of bubaline pregnancy associated glycoprotein 2
Ganguly B and Prasad S
Journal of Animal Science and Biotechnology 2012, 3:13
Molecular Docking of Aromatase Inhibitors
Suvannang N, Nantasenamat C, Isarankura-Na-Ayudhya C, Prachayasittikul V
Molecules 2011, 16(5):3597-3617
Enzyme closure and nucleotide binding structurally lock guanylate kinase
Delalande O, Sacquin-Mora S, Baaden M
Biophys J. 2011 Sep 21;101(6):1440-9
Plasmin substrate binding site cooperativity guides the design of potent peptide aldehyde inhibitors
Swedberg JE, Harris JM
Biochemistry. 2011 Oct 4;50(39):8454-62
Structural basis for agonism and antagonism for a set of chemically related progesterone receptor modulators
Lusher SJ, Raaijmakers HC, Vu-Pham D, Dechering K, Lam TW, Brown AR, Hamilton NM, Nimz O, Bosch R, McGuire R, Oubrie A, de Vlieg J
J Biol Chem. 2011 Oct 7;286(40):35079-86
Toward the molecular basis of inherited prion diseases: NMR structure of the human prion protein with V210I mutation
Biljan I, Ilc G, Giachin G, Raspadori A, Zhukov I, Plavec J, Legname G
J Mol Biol. 2011 Sep 30;412(4):660-73
An NMR structure determined with the help of YASARA, PDB ID 2LEJ
Structural basis of slow activation gating in the cardiac I Ks channel complex.
Strutz-Seebohm N, Pusch M, Wolf S, Stoll R, Tapken D, Gerwert K, Attali B,Seebohm G.
Cell Physiol Biochem. 2011;27(5):443-52. Epub 2011 Jun
Mastering the canonical loop of serine protease inhibitors: enhancing potency by optimising the internal hydrogen bond network
Swedberg JE, de Veer SJ, Sit KC, Reboul CF, Buckle AM, Harris JM
PLoS One. 2011 Apr 27;6(4):e19302
How to remain nonfolded and pliable: the linkers in modular alpha-amylases as a case study.
Feller G, Dehareng D, Lage JL
FEBS J. 2011 Jul;278(13):2333-40
Inhibition of Kir2.1 (KCNJ2) by the AMP-activated protein kinase.
Alesutan I, Munoz C, Sopjani M, Dermaku-Sopjani M, Michael D, Fraser S, Kemp BE, Seebohm G, Foeller M, Lang F.
Biochem Biophys Res Commun. 2011 May 20;408(4):505-10
Aminoacyl-coenzyme A synthesis catalyzed by a CoA ligase from Penicillium chrysogenum
Koetsier MJ, Jekel PA, Wijma HJ, Bovenberg RA, Janssen DB
FEBS Lett. 2011 Mar 23;585(6):893-8
Computational characterization of the substrate-binding mode in coproporphyrinogen III oxidase
Silva PJ, Ramos MJ
J Phys Chem B. 2011 Mar 3;115(8):1903-10
The Molecular Basis of Sex: Linking Yeast to Human
Swanson WJ, Aagaard JE, Vacquier VD, Monne M, Al Hosseini HS, Jovine L
Mol Biol Evol. 2011 Jan 31
Kinetic Resolution of alpha-Bromoamides: Experimental and Theoretical Investigation of Highly Enantioselective Reactions Catalyzed by Haloalkane Dehalogenases
Westerbeek, A Szymanski, W Wijma, HJ, Marrink, SJ, Feringa, BL, Janssen, DB
Adv. Synth. Catal. 353, 931-944
Structure-Function Relationship of Cytoplasmic and Nuclear IkB Proteins: An In Silico Analysis
Manavalan B, Basith S, Choi YM, Lee G, Choi S
PLoS One. 2010 Dec 23;5(12):e15782
A series of PDB related databases for everyday needs
Joosten RP, te Beek TA, Krieger E, Hekkelman ML, Hooft RW, Schneider R, Sander C, Vriend G
Nucleic Acids Res. 2011 Jan;39(Database issue):D411-9
Modulation of human ether a gogo related channels by CASQ2 contributes to etiology of catecholaminergic polymorphic ventricular tachycardia (CPVT).
Eckey K, Strutz-Seebohm N, Katz G, Fuhrmann G, Henrion U, Pott L, Linke WA, Arad M, Lang F, Seebohm G.
Cell Physiol Biochem. 2010;26(4-5):503-12. Epub 2010 Oct
HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing?
Santos PC, Pereira AC, Cancado RD, Schettert IT, Sobreira TJ, Oliveira PS, Hirata RD, Hirata MH, Figueiredo MS, Chiattone CS, Krieger JE, Guerra-Shinohara EM
Blood Cells Mol Dis. 2010 Dec 15;45(4):302-7
DFG-in and DFG-out homology models of TrkB kinase receptor: Induced-fit and ensemble docking
Podlipnik C, Tutino F, Bernardi A, Seneci P
J Mol Graph Model. 2010 Oct 7
Insights into Egg Coat Assembly and Egg-Sperm Interaction from the X-Ray Structure of Full-Length ZP3
Han L, Monne M, Okumura H, Schwend T, Cherry AL, Flot D, Matsuda T, Jovine L
Cell. 2010 Oct 20
Residues at the tip of the pore loop of NR3B-containing NMDA receptors determine Ca2+ permeability and Mg2+ block.
Cavara NA, Orth A, Hicking G, Seebohm G, Hollmann M.
BMC Neurosci. 2010 Oct 19;11:133.
Engineering of an enantioselective tyrosine aminomutase by mutation of a single active site residue in phenylalanine aminomutase
Wu B, Szymański W, Wijma HJ, Crismaru CG, de Wildeman S, Poelarends GJ, Feringa BL, Janssen DB
Chem Commun (Camb). 2010 Nov 21;46(43):8157-9
Two-dimensional heteronuclear saturation transfer difference NMR reveals detailed integrin avb6 protein-peptide interactions
Wagstaff JL, Vallath S, Marshall JF, Williamson RA, Howard MJ
Chem Commun (Camb). 2010 Oct 28;46(40):7533-5
NMR structure of the human prion protein with the pathological Q212P mutation reveals unique structural features
Ilc G, Giachin G, Jaremko M, Jaremko L, Benetti F, Plavec J, Zhukov I, Legname G
PLoS One. 2010 Jul 22;5(7):e11715
The {alpha}-galactosidase type A gene aglA from Aspergillus niger encodes a fully functional {alpha}-N-acetylgalactosaminidase
Kulik N, Weignerova L, Filipi T, Pompach P, Novak P, Mrazek H, Slamova K, Bezouska K, Kren V, Ettrich R
Glycobiology. 2010 Nov;20(11):1410-9
In silico prediction of the 3D structure of trimeric asialoglycoprotein receptor bound to triantennary oligosaccharide
Ramadugu SK, Chung YH, Fuentes EJ, Rice KG, Margulis CJ
J Am Chem Soc. 2010 Jul 7;132(26):9087-95
Monte Carlo-based rigid body modelling of large protein complexes against small angle scattering data
Meesters C, Pairet B, Rabenhorst A, Decker H, Jaenicke E
Comput Biol Chem. 2010 Jun;34(3):158-64
A Tale of Two Acids: When Arginine Is a More Appropriate Acid than H(3)O(+)
Silva PJ, Schulz C, Jahn D, Jahn M, Ramos MJ
J Phys Chem B. 2010 Jun 16
Systematic structure-function analysis of androgen receptor Leu701 mutants explains the properties of the prostate cancer mutant L701H
van de Wijngaart DJ, Molier M, Lusher SJ, Hersmus R, Jenster G, Trapman J, Dubbink HJ
J Biol Chem. 2010 Feb 12;285(7):5097-105
Factor VIII-eGFP fusion proteins with preserved functional activity for the analysis of the early secretory pathway of factor VIII.
Heinz S, Schuettrumpf J, Simpson JC, Pepperkok R, Nicolaes GA, Abriss D, Milanov P, Roth S, Seifried E, Tonn T.
Thromb Haemost. 2009 Nov;102(5):925-35. doi: 10.1160/TH08-12-0807.
Homology modelling and spectroscopy, a never-ending love story
Venselaar H, Joosten RP, Vroling B, Baakman CA, Hekkelman ML, Krieger E, Vriend G
Eur Biophys J. 2010 Mar;39(4):551-63
Molecular dynamics analysis of the wild type and dF508 mutant structures of the human CFTR-nucleotide binding domain 1
Bisignano P, Moran O
Biochimie. 2010 Jan;92(1):51-57
Folding defects in P-type ATP 8B1 associated with hereditary cholestasis are ameliorated by 4-phenylbutyrate
van der Velden LM, Stapelbroek JM, Krieger E, van den Berghe PV, Berger R, Verhulst PM, Holthuis JC, Houwen RH, Klomp LW, van de Graaf SF
Hepatology. 2010 Jan;51(1):286-96
CASP8 Special issueImproving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8
Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K
Proteins. 2009;77 Suppl 9:114-22
The journal cover shows how the knowledge-based potentials in the YASARA force field cover the various dihedral angles of an arginine residue.
PDB_REDOPDB_REDO: automated re-refinement of X-ray structure models in the PDB
Joosten RP, Salzemann J, Bloch V, Stockinger H, Berglund AC, Blanchet C, Bongcam-Rudloff E, Combet C, Da Costa AL, Deleage G, Diarena M, Fabbretti R, Fettahi G, Flegel V, Gisel A, Kasam V, Kervinen T, Korpelainen E, Mattila K, Pagni M, Reichstadt M, Breton V, Tickle IJ and Vriend G
J. Appl. Cryst. (2009). 42, 376-384
Journal cover made with YASARA.
Challenging a paradigm: theoretical calculations of the protonation state of the Cys25-His159 catalytic diad in free papain
Shokhen M, Khazanov N, Albeck A.
Proteins. 2009 Dec;77(4):916-26
Reduced expression of ATP7B affected by Wilson disease-causing mutations is rescued by pharmacological folding chaperones 4-phenylbutyrate and curcumin
van den Berghe PV, Stapelbroek JM, Krieger E, de Bie P, van de Graaf SF, de Groot RE, van Beurden E, Spijker E, Houwen RH, Berger R, Klomp LW
Hepatology. 2009 Dec;50(6):1783-95
Antibacterial activity of six novel peptides from Tityus discrepans scorpion venom. A fluorescent probe study of microbial membrane Na+ permeability changes
Diaz P, D'Suze G, Salazar V, Sevcik C, Shannon JD, Sherman NE, Fox JW.
Toxicon. 2009 Nov;54(6):802-17
Proteome-wide substrate analysis indicates substrate exclusion as a mechanism to generate caspase-7 versus caspase-3 specificity
Demon D, Van Damme P, Vanden Berghe T, Deceuninck A, Van Durme J, Verspurten J, Helsens K, Impens F, Wejda M, Schymkowitz J, Rousseau F, Madder A, Vandekerckhove J, Declercq W, Gevaert K, Vandenabeele P
Mol Cell Proteomics. 2009 Sep 16
Homology modelling and spectroscopy, a never-ending love story
Venselaar H, Joosten RP, Vroling B, Baakman CA, Hekkelman ML, Krieger E, Vriend G
Eur Biophys J. 2009 Aug 29
Molecular Dynamics Analysis Of The Wild Type And dF508 Mutant Structures Of The Human CFTR-Nucleotide Binding Domain 1
Bisignano P and Moran O
Biochemie (2009) in press
BBA cover Structural organization of WrbA in apo- and holoprotein crystals
Wolfova J, Smatanova IK, Brynda J, Mesters JR, Lapkouski M, Kuty M, Natalello A, Chatterjee N, Chern SY, Ebbel E, Ricci A, Grandori R, Ettrich R, Carey J
Biochim Biophys Acta. 2009 Sep;1794(9):1288-98 Journal cover made with YASARA:
Structure cover Protein-peptide interactions adopt the same structural motifs as monomeric protein folds
Vanhee P, Stricher F, Baeten L, Verschueren E, Lenaerts T, Serrano L, Rousseau F, Schymkowitz J
Structure. 2009 Aug 12;17(8):1128-36 Journal cover made with YASARA:
Accurate prediction of DnaK-peptide binding via homology modelling and experimental data
Van Durme J, Maurer-Stroh S, Gallardo R, Wilkinson H, Rousseau F, Schymkowitz J
PLoS Comput Biol. 2009 Aug;5(8):e1000475
Long QT syndrome-associated mutations in the voltage sensor of I(Ks) channels.
Henrion U, Strutz-Seebohm N, Duszenko M, Lang F, Seebohm G.
Cell Physiol Biochem. 2009;24(1-2):11-6. Epub 2009 Jul 1.
Structure of the tyrosine-sulfated C5a receptor N terminus in complex with chemotaxis inhibitory protein of Staphylococcus aureus
Ippel JH, de Haas CJ, Bunschoten A, van Strijp JA, Kruijtzer JA, Liskamp RM, Kemmink J
J Biol Chem. 2009 May 1;284(18):12363-72
Mapping the sequence mutations of the 2009 H1N1 influenza A virus neuraminidase relative to drug and antibody binding sites
Maurer-Stroh S, Ma J, Lee RT, Sirota FL, Eisenhaber F
Biol Direct. 2009 May 20;4(1):18
Structure of the tyrosine-sulfated C5a receptor N terminus in complex with chemotaxis inhibitory protein of Staphylococcus aureus
Ippel JH, de Haas CJ, Bunschoten A, van Strijp JA, Kruijtzer JA, Liskamp RM, Kemmink J
J Biol Chem. 2009 May 1;284(18):12363-72
An NMR structure determined with the help of YASARA, PDB ID 2K3U
Protein sequences encode safeguards against aggregation
Reumers J, Maurer-Stroh S, Schymkowitz J, Rousseau F
Hum Mutat. 2009 Mar;30(3):431-7
A single residue influences the reaction mechanism of ammonia lyases and mutases
Bartsch S and Bornscheuer UT
Angew Chem Int Ed Engl. 2009;48(18):3362-5
Brominated phenols as auxin-like molecules
Spaepena S, Van Durme J, Dasa F, Maurer-Stroh S, Rousseau F, Schymkowitzb J and Vanderleydena J
Europ. J. of Soil Biol. 2009;45:81-87
Functional Role of Arginine 375 in Transmembrane Helix 6 of Multidrug Resistance Protein 4 (MRP4/ABCC4)
El-Sheikh AA, van den Heuvel JJ, Krieger E, Russel FG, Koenderink JB
Mol Pharmacol. 2008 Oct;74(4):964-71
Differential blocking effects of the acetaldehyde-derived DNA lesion N2-ethyl-2'-deoxyguanosine on transcription by multisubunit and single subunit RNA polymerases
Cheng TF, Hu X, Gnatt A, Brooks PJ
J Biol Chem. 2008 Oct 10;283(41):27820-8
Structural characterization of the alpha-hemolysin monomer from Staphylococcus aureus
Meesters C, Brack A, Hellmann N, Decker H
Proteins. 2008 Sep 17;75(1):118-126
The crystal structure of the platelet activator aggretin reveals a novel (alphabeta)2 dimeric structure
Hooley E, Papagrigoriou E, Navdaev A, Pandey AV, Clemetson JM, Clemetson KJ, Emsley J
Biochemistry. 2008 Jul 29;47(30):7831-7
A Software Library for Monte Carlo-Based Rigid Body Modelling Against Small Angle Scattering Data
Meesters C
From Computational Biophysics to Systems Biology (CBSB08) NIC Series, Vol. 40
Identification of surface epitopes of human coagulation factor Va which are important for interaction with activated protein C and heparin
Segers K, Dahlback B, Rosing J, Nicolaes GA
J Biol Chem. 2008 Jun 2
Complete inversion of enantioselectivity towards acetylated tertiary alcohols by a double mutant of a Bacillus subtilis esterase
Bartsch S, Kourist R, Bornscheuer UT
Angew Chem Int Ed Engl. 2008;47(8):1508-11
Cover Hepcidin: from discovery to differential diagnosis
Kemna EHJM, Tjalsma H, Willems HL, Swinkels DW
Haematologica, 93(1):90-97. Journal cover made with YASARA:
A three-dimensional model of mammalian tyrosinase active site accounting for loss of function mutations
Schweikardt T, Olivares C, Solano F, Jaenicke E, Garcia-Borron JC, Decker H
Pigment Cell Res. 2007 Oct;20(5):394-401
MYO15A (DFNB3) mutations in Turkish hearing loss families and functional modeling of a novel motor domain mutation
Kalay E, Uzumcu A, Krieger E, Caylan R, Uyguner O, Ulubil-Emiroglu M, Erdol H, Kayserili H, Hafiz G, Baserer N, Heister AJ, Hennies HC, Nurnberg P, Basaran S, Brunner HG, Cremers CW, Karaguzel A, Wollnik B, Kremer H
Am J Med Genet A. 2007 Oct 15;143(20):2382-9
Structural diversity in twin-arginine signal peptide-binding proteins
Maillard J, Spronk CA, Buchanan G, Lyall V, Richardson DJ, Palmer T, Vuister GW, Sargent F
Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15641-6
An NMR structure determined with the help of YASARA, PDB ID 2JSX
Screening of the active site from water by the incoming ligand triggers catalysis and inhibition in serine proteases
Shokhen M, Khazanov N, Albeck A
Proteins. 2007 Oct 2
Similar enzyme activation and catalysis in hemocyanins and tyrosinases
Decker H, Schweikardt T, Nillius D, Salzbrunn U, Jaenicke E, Tuczek F
Gene. 2007 Aug 15;398(1-2):183-91
Clinical, structural and functional implications of mutations and polymorphisms in human NADPH P450 oxidoreductase
Fluck CE, Nicolo C, Pandey AV
Fundam Clin Pharmacol. 2007 Aug;21(4):399-410
The cytochrome P450 aromatase lacking exon 5 is associated with a phenotype of nonclassic aromatase deficiency and is also present in normal human steroidogenic tissues
Pepe CM, Saraco NI, Baquedano MS, Guercio G, Vaiani E, Marino R, Pandey AV, Fluck CE, Rivarola MA, Belgorosky A
Clin Endocrinol (Oxf). 2007 Jul 2
Amino acids in the second transmembrane helix of the Lhca4 subunit are important for formation of stable heterodimeric light-harvesting complex LHCI-730
Corbet D, Schweikardt T, Paulsen H, Schmid VH
J Mol Biol. 2007 Jun 29;370(1):170-82
Modulation of human cyp19a1 activity by mutant nadph p450 oxidoreductase
Pandey AV, Kempna P, Hofer G, Mullis PE, Fluck CE
Mol Endocrinol. 2007 Jun 26
MPP1 links the Usher protein network and the Crumbs protein complex in the retina
Gosens I, van Wijk E, Kersten FF, Krieger E, van der Zwaag B, Marker T, Letteboer SJ, Dusseljee S, Peters T, Spierenburg HA, Punte IM, Wolfrum U, Cremers FP, Kremer H, Roepman R
Hum Mol Genet. 2007 Jun 21
Structure of the dimeric N-glycosylated form of fungal beta-N-acetylhexosaminidase revealed by computer modeling, vibrational spectroscopy, and biochemical studies
Ettrich R, Kopecky V Jr, Hofbauerova K, Baumruk V, Novak P, Pompach P, Man P, Plihal O, Kuty M, Kulik N, Sklenar J, Ryslava H, Kren V, Bezouska K
BMC Struct Biol. 2007 May 17;7:32
PSA/KLK3 AREI promoter polymorphism alters androgen receptor binding and is associated with prostate cancer susceptibility
Lai J, Kedda MA, Hinze K, Smith RL, Yaxley J, Spurdle AB, Morris CP, Harris J, Clements JA
Carcinogenesis. 2006 Dec 13
Influence of modulated structural dynamics on the kinetics of alpha-chymotrypsin catalysis. Insights through chemical glycosylation, molecular dynamics and domain motion analysis
Sola RJ, Griebenow K
FEBS J. 2006 Dec;273(23):5303-19
The human Vps29 retromer component is a metallo-phosphoesterase for a cation-independent mannose 6-phosphate receptor substrate peptide
Damen E, Krieger E, Nielsen JE, Eygensteyn J, van Leeuwen JE
Biochem J. 2006 Sep 15;398(3):399-409
Structure-function analysis of the coxsackievirus protein 3A: identification of residues important for dimerization, viral RNA replication, and transport inhibition
Wessels E, Notebaart RA, Duijsings D, Lanke K, Vergeer B, Melchers WJ, van Kuppeveld FJ
J Biol Chem. 2006 281(38):28232-43
The first crystal structure of tyrosinase: all questions answered?
Decker H, Schweikardt T, Tuczek F
Angew Chem Int Ed Engl. 2006 Jul 10;45(28):4546-50
Arrestin interaction with rhodopsin: conceptual models
Modzelewska A, Filipek S, Palczewski K, Park PS
Cell Biochem Biophys. 2006;46(1):1-15
Structural models of the snake venom factor V activators from Daboia russelli and Daboia lebetina
Segers K, Rosing J, Nicolaes GA
Proteins. 2006 Sep 1;64(4):968-84
CoverGRIS: Glycoprotein-Hormone Receptor Information System.
Van Durme J, Horn F, Costagliola S, Vriend G , Vassart G
Mol Endocrinol. 2006 Sep;20(9):2247-55 Journal cover partly made with YASARA:
Completely buried, non-ion-paired glutamic acid contributes favorably to the conformational stability of pyrrolidone carboxyl peptidases from hyperthermophiles.
Kaushik JK, Iimura S, Ogasahara K, Yamagata Y , Segawa S, Yutani K
Biochemistry. 2006 Jun 13;45(23):7100-12.
Structure cover GTP-Ras Disrupts the Intramolecular Complex of C1 and RA Domains of Nore1.
Harjes E, Harjes S, Wohlgemuth S, Muller KH , Krieger E, Herrmann C, Bayer P.
Structure 2006 May;14(5):881-8
An NMR structure determined with the help of YASARA, PDB ID 2FNF. Journal cover made with YASARA:
Fast empirical pK(a) prediction by Ewald summation.
Krieger E, Nielsen JE, Spronk CA, Vriend G.
J Mol Graph Model. 2006 Apr 25
The presence of multiple and differentially regulated interleukin-12p40 genes in bony fishes signifies an expansion of the vertebrate heterodimeric cytokine family.
Huising MO, van Schijndel JE, Kruiswijk CP, Nabuurs SB , Savelkoul HF, Flik G, Verburg-van Kemenade BM
Mol Immunol. 2006 Apr;43(10):1519-33
Repulsive separation of the cytoplasmic ends of transmembrane helices 3 and 6 is linked to receptor activation in a novel thyrotropin receptor mutant (M626I).
Ringkananont U, Van Durme J, Montanelli L , Ugrasbul F, Yu YM, Weiss RE, Refetoff S, Grasberger H .
Mol Endocrinol. 2006 Apr;20(4):893-903
ZNF674: A New Kruppel-Associated Box-Containing Zinc-Finger Gene Involved in Nonsyndromic X-Linked Mental Retardation.
Lugtenberg D, Yntema HG, Banning MJ, Oudakker AR , Firth HV, Willatt L, Raynaud M, Kleefstra T, Fryns JP , Ropers HH, Chelly J, Moraine C, Gecz J, Reeuwijk J , Nabuurs SB, de Vries BB, Hamel BC, de Brouwer AP, Bokhoven H
Am J Hum Genet. 2006 Feb;78(2):265-78
A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.
Kalay E, de Brouwer AP, Caylan R, Nabuurs SB , Wollnik B, Karaguzel A, Heister JG, Erdol H, Cremers FP , Cremers CW, Brunner HG, Kremer H.
J Mol Med. 2005 Dec;83(12):1025-32.
A novel GCAP1 missense mutation (L151F) in a large family with autosomal dominant cone-rod dystrophy (adCORD)
Sokal I, Dupps WJ, Grassi MA, Brown J Jr, Affatigato LM, Roychowdhury N, Yang L, Filipek S, Palczewski K, Stone EM, Baehr W
Invest Ophthalmol Vis Sci. 2005 Apr;46(4):1124-32
Interaction of nephrocystin-4 and RPGRIP1 is disrupted by nephronophthisis or Leber congenital amaurosis-associated mutations.
Roepman R, Letteboer SJ, Arts HH, van Beersum SE , Lu X, Krieger E, Ferreira PA, Cremers FP.
Proc Natl Acad Sci U S A. 2005 Dec 20;102(51):18520-5
A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.
Kalay E, de Brouwer AP, Caylan R, Nabuurs SB , Wollnik B, Karaguzel A, Heister JG, Erdol H, Cremers FP , Cremers CW, Brunner HG, Kremer H.
J Mol Med. 2005 Dec;83(12):1025-32
Definition of a new information-based per-residue quality parameter.
Nabuurs SB, Krieger E, Spronk CA, Nederveen AJ , Vriend G, Vuister GW.
J Biomol NMR. 2005 Oct;33(2):123-34.
Presence and absence of FSH receptor mutations provide some insights to spontaneous ovarian hyperstimulation syndrome physiopathology.
De Leener A, Montanelli L, Van Durme J, Chae H , Smits G, Vassart G, Costagliola S.
J Clin Endocrinol Metab. 2005 Nov 8;
JBC coverReconstruction of the Complete Ouabain-binding Pocket of Na,K-ATPase in Gastric H,K-ATPase by Substitution of Only Seven Amino Acids.
Qiu LY, Krieger E, Schaftenaar G, Swarts HG , Willems PH, De Pont JJ, Koenderink JB.
J Biol Chem. 2005 Sep 16;280(37):32349-55 Journal cover made with YASARA:
MPP5 recruits MPP4 to the CRB1 complex in photoreceptors.
Kantardzhieva A, Gosens I, Alexeeva S, Punte IM , Versteeg I, Krieger E, Neefjes-Mol CA, den Hollander AI , Letteboer SJ, Klooster J, Cremers FP, Roepman R, Wijnholds J .
Invest Ophthalmol Vis Sci. 2005 Jun;46(6):2192-201
Asn792 Participates in the Hydrogen Bond Network Around the K+-binding Pocket of Gastric H,K-ATPase.
Swarts HG, Koenderink JB, Willems PH, Krieger E, De Pont JJ.
J Biol Chem. 2005 Mar 25;280(12):11488-94
A Proline-Rich Region in the Coxsackievirus 3A Protein Is Required for the Protein To Inhibit Endoplasmic Reticulum-to-Golgi Transport.
Wessels E, Duijsings D, Notebaart RA, Melchers WJ, van Kuppeveld FJ.
J Virol. 2005 Apr;79(8):5163-73
Protein sequence randomization: efficient estimation of protein stability using knowledge-based potentials.
Wiederstein M, Sippl MJ.
J Mol Biol. 2005 Feb 4;345(5):1199-212
Validation of protein structures derived by NMR spectroscopy.
Spronk CA, Nabuurs SB, Krieger E, Vriend G, Vuister GW.
Progress in NMR spectroscopy. 2004 45:315-337.
Making optimal use of empirical energy functions: Force-field parameterization in crystal space.
Krieger E, Darden T, Nabuurs SB, Finkelstein A, Vriend G.
Proteins. 2004 57(4):678-683
Delineation of the discontinuous-conformational epitope of a monoclonal antibody displaying full in vitro and in vivo thyrotropin activity.
Costagliola S, Bonomi M, Morgenthaler NG, Van Durme J, Panneels V, Refetoff S, Vassart G.
Mol Endocrinol. 2004 18(12):3020-34 Journal cover made with YASARA:
OmpT: Molecular Dynamics Simulations of an Outer Membrane Enzyme.
Baaden M, Sansom MS.
Biophys J. 2004 87(5):2942-53
Identification of the MMRN1 binding region within the C2 domain of human factor V.
Jeimy SB, Woram RA, Fuller N, Quinn-Allen MA, Nicolaes GA, Dahlback B, Kane WH, Hayward CP.
J Biol Chem. 2004 279(49):51466-71
DRESS: a database of REfined solution NMR structures.
Nabuurs SB, Nederveen AJ, Vranken W, Doreleijers JF, Bonvin AM, Vuister GW, Vriend G, Spronk CA.
Proteins. 2004 55(3):483-6.
Identification and molecular modelling of a mutation in the motor head domain of myosin VIIA in a family with autosomal dominant hearing impairment (DFNA11).
Luijendijk MW, Van Wijk E, Bischoff AM, Krieger E, Huygen PL, Pennings RJ, Brunner HG, Cremers CW, Cremers FP, Kremer H.
Hum Genet. 2004 115(2):149-56.
A conformation-specific interhelical salt bridge in the K+ binding site of gastric H,K-ATPase.
Koenderink JB, Swarts HG, Willems PH, Krieger E, De Pont JJ.
J Biol Chem. 2004 279(16):16417-24.
A structural and dynamic model for the interaction of interleukin-8 and glycosaminoglycans: support from isothermal fluorescence titrations.
Krieger E, Geretti E, Brandner B, Goger B, Wells TN, Kungl AJ.
Proteins. 2004 54(4):768-75.
A mutation in the gamma actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26).
van Wijk E, Krieger E, Kemperman MH, De Leenheer EM, Huygen PL, Cremers CW, Cremers FP, Kremer H.
J Med Genet. 2003 40(12):879-84.
Fluorescence analysis of the Hansenula polymorpha peroxisomal targeting signal-1 receptor, Pex5p.
Boteva R, Koek A, Visser NV, Visser AJ, Krieger E, Zlateva T, Veenhuis M, van der Klei I.
Eur J Biochem. 2003 270(21):4332-8.
DJ-1( PARK7), a novel gene for autosomal recessive, early onset parkinsonism.
Bonifati V, Rizzu P, Squitieri F, Krieger E, Vanacore N, van Swieten JC, Brice A, van Duijn CM, Oostra B, Meco G, Heutink P.
Neurol Sci. 2003 24(3):159-60.
Quantitative Evaluation of Experimental NMR Restraints.
Nabuurs SB, Spronk CA, Krieger E, Maassen H, Vriend G, Vuister GW.
J Am Chem Soc. 2003 125(39):12026-12034.
The precision of NMR structure ensembles revisited.
Spronk CA, Nabuurs SB, Bonvin AM, Krieger E, Vuister GW, Vriend G.
J Biomol NMR. 2003 25(3):225-34.
Homology modeling.
Krieger E, Nabuurs SB, Vriend G.
Methods Biochem Anal. 2003;44:509-23.
Mutations in the DJ-1 gene associated with autosomal recessive early-onset parkinsonism.
Bonifati V, Rizzu P, van Baren MJ, Schaap O, Breedveld GJ, Krieger E, Dekker MC, Squitieri F, Ibanez P, Joosse M, van Dongen JW, Vanacore N, van Swieten JC, Brice A, Meco G, van Duijn CM, Oostra BA, Heutink P.
Science. 2003 299(5604):256-9
A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia.
van Swieten JC, Brusse E, de Graaf BM, Krieger E, van de Graaf R, de Koning I, Maat-Kievit A, Leegwater P, Dooijes D, Oostra BA, Heutink P.
Am J Hum Genet. 2003 72(4):1078.
Increasing the precision of comparative models with YASARA NOVA--a self-parameterizing force field.
Krieger E, Koraimann G, Vriend G.
Proteins. 2002 47(3):393-402.
Gain-of-function mutation in ADULT syndrome reveals the presence of a second transactivation domain in p63.
Duijf PH, Vanmolkot KR, Propping P, Friedl W, Krieger E, McKeon F, Dotsch V, Brunner HG, van Bokhoven H.
Hum Mol Genet. 2002 11(7):799-804.
Identification of different binding sites in the dendritic cell-specific receptor DC-SIGN for intercellular adhesion molecule 3 and HIV-1.
Geijtenbeek TB, van Duijnhoven GC, van Vliet SJ, Krieger E, Vriend G, Figdor CG, van Kooyk Y.
J Biol Chem. 2002 277(13):11314-20.
Models@Home: distributed computing in bioinformatics using a screensaver based approach.
Krieger E, Vriend G.
Bioinformatics. 2002 18(2):315-8.