Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA in press

Please also notify us in case you use YASARA yourself and have a paper to be added here, which mentions YASARA.



Mixed inhibition of adenosine deaminase activity by 1,3-dinitrobenzene: a model for understanding cell-selective neurotoxicity in chemically-induced energy deprivation syndromes in brain
Wang Y, Liu X, Schneider B, Zverina EA, Russ K, Wijeyesakere SJ, Fierke CA, Richardson RJ, Philbert MA
Toxicol Sci. 2012 Feb;125(2):509-21
Molecular Docking of Aromatase Inhibitors
Suvannang N, Nantasenamat C, Isarankura-Na-Ayudhya C, Prachayasittikul V
Molecules 2011, 16(5):3597-3617
Plasmin substrate binding site cooperativity guides the design of potent peptide aldehyde inhibitors
Swedberg JE, Harris JM
Biochemistry. 2011 Oct 4;50(39):8454-62
How to remain nonfolded and pliable: the linkers in modular alpha-amylases as a case study.
Feller G, Dehareng D, Lage JL
FEBS J. 2011 Jul;278(13):2333-40
Mastering the canonical loop of serine protease inhibitors: enhancing potency by optimising the internal hydrogen bond network
Swedberg JE, de Veer SJ, Sit KC, Reboul CF, Buckle AM, Harris JM
PLoS One. 2011 Apr 27;6(4):e19302
Computational characterization of the substrate-binding mode in coproporphyrinogen III oxidase
Silva PJ, Ramos MJ
J Phys Chem B. 2011 Mar 3;115(8):1903-10
The Molecular Basis of Sex: Linking Yeast to Human
Swanson WJ, Aagaard JE, Vacquier VD, Monne M, Al Hosseini HS, Jovine L
Mol Biol Evol. 2011 Jan 31
A series of PDB related databases for everyday needs
Joosten RP, te Beek TA, Krieger E, Hekkelman ML, Hooft RW, Schneider R, Sander C, Vriend G
Nucleic Acids Res. 2011 Jan;39(Database issue):D411-9
Structure-Function Relationship of Cytoplasmic and Nuclear IkB Proteins: An In Silico Analysis
Manavalan B, Basith S, Choi YM, Lee G, Choi S
PLoS One. 2010 Dec 23;5(12):e15782
HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing?
Santos PC, Pereira AC, Cancado RD, Schettert IT, Sobreira TJ, Oliveira PS, Hirata RD, Hirata MH, Figueiredo MS, Chiattone CS, Krieger JE, Guerra-Shinohara EM
Blood Cells Mol Dis. 2010 Dec 15;45(4):302-7
Two-dimensional heteronuclear saturation transfer difference NMR reveals detailed integrin avb6 protein-peptide interactions
Wagstaff JL, Vallath S, Marshall JF, Williamson RA, Howard MJ
Chem Commun (Camb). 2010 Oct 28;46(40):7533-5
DFG-in and DFG-out homology models of TrkB kinase receptor: Induced-fit and ensemble docking
Podlipnik C, Tutino F, Bernardi A, Seneci P
J Mol Graph Model. 2010 Oct 7
Engineering of an enantioselective tyrosine aminomutase by mutation of a single active site residue in phenylalanine aminomutase
Wu B, SzymaƄski W, Wijma HJ, Crismaru CG, de Wildeman S, Poelarends GJ, Feringa BL, Janssen DB
Chem Commun (Camb). 2010 Nov 21;46(43):8157-9
Insights into Egg Coat Assembly and Egg-Sperm Interaction from the X-Ray Structure of Full-Length ZP3
Han L, Monne M, Okumura H, Schwend T, Cherry AL, Flot D, Matsuda T, Jovine L
Cell. 2010 Oct 20
The {alpha}-galactosidase type A gene aglA from Aspergillus niger encodes a fully functional {alpha}-N-acetylgalactosaminidase
Kulik N, Weignerova L, Filipi T, Pompach P, Novak P, Mrazek H, Slamova K, Bezouska K, Kren V, Ettrich R
Glycobiology. 2010 Nov;20(11):1410-9
NMR structure of the human prion protein with the pathological Q212P mutation reveals unique structural features
Ilc G, Giachin G, Jaremko M, Jaremko L, Benetti F, Plavec J, Zhukov I, Legname G
PLoS One. 2010 Jul 22;5(7):e11715
In silico prediction of the 3D structure of trimeric asialoglycoprotein receptor bound to triantennary oligosaccharide
Ramadugu SK, Chung YH, Fuentes EJ, Rice KG, Margulis CJ
J Am Chem Soc. 2010 Jul 7;132(26):9087-95
Monte Carlo-based rigid body modelling of large protein complexes against small angle scattering data
Meesters C, Pairet B, Rabenhorst A, Decker H, Jaenicke E
Comput Biol Chem. 2010 Jun;34(3):158-64
A Tale of Two Acids: When Arginine Is a More Appropriate Acid than H(3)O(+)
Silva PJ, Schulz C, Jahn D, Jahn M, Ramos MJ
J Phys Chem B. 2010 Jun 16
Homology modelling and spectroscopy, a never-ending love story
Venselaar H, Joosten RP, Vroling B, Baakman CA, Hekkelman ML, Krieger E, Vriend G
Eur Biophys J. 2010 Mar;39(4):551-63
Molecular dynamics analysis of the wild type and dF508 mutant structures of the human CFTR-nucleotide binding domain 1
Bisignano P, Moran O
Biochimie. 2010 Jan;92(1):51-57
Folding defects in P-type ATP 8B1 associated with hereditary cholestasis are ameliorated by 4-phenylbutyrate
van der Velden LM, Stapelbroek JM, Krieger E, van den Berghe PV, Berger R, Verhulst PM, Holthuis JC, Houwen RH, Klomp LW, van de Graaf SF
Hepatology. 2010 Jan;51(1):286-96
CASP8 Special issueImproving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8
Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K
Proteins. 2009;77 Suppl 9:114-22
The journal cover shows how the knowledge-based potentials in the YASARA force field cover the various dihedral angles of an arginine residue.
PDB_REDOPDB_REDO: automated re-refinement of X-ray structure models in the PDB
Joosten RP, Salzemann J, Bloch V, Stockinger H, Berglund AC, Blanchet C, Bongcam-Rudloff E, Combet C, Da Costa AL, Deleage G, Diarena M, Fabbretti R, Fettahi G, Flegel V, Gisel A, Kasam V, Kervinen T, Korpelainen E, Mattila K, Pagni M, Reichstadt M, Breton V, Tickle IJ and Vriend G
J. Appl. Cryst. (2009). 42, 376-384
Journal cover made with YASARA.
Challenging a paradigm: theoretical calculations of the protonation state of the Cys25-His159 catalytic diad in free papain
Shokhen M, Khazanov N, Albeck A.
Proteins. 2009 Dec;77(4):916-26
Reduced expression of ATP7B affected by Wilson disease-causing mutations is rescued by pharmacological folding chaperones 4-phenylbutyrate and curcumin
van den Berghe PV, Stapelbroek JM, Krieger E, de Bie P, van de Graaf SF, de Groot RE, van Beurden E, Spijker E, Houwen RH, Berger R, Klomp LW
Hepatology. 2009 Dec;50(6):1783-95
Proteome-wide substrate analysis indicates substrate exclusion as a mechanism to generate caspase-7 versus caspase-3 specificity
Demon D, Van Damme P, Vanden Berghe T, Deceuninck A, Van Durme J, Verspurten J, Helsens K, Impens F, Wejda M, Schymkowitz J, Rousseau F, Madder A, Vandekerckhove J, Declercq W, Gevaert K, Vandenabeele P
Mol Cell Proteomics. 2009 Sep 16
Homology modelling and spectroscopy, a never-ending love story
Venselaar H, Joosten RP, Vroling B, Baakman CA, Hekkelman ML, Krieger E, Vriend G
Eur Biophys J. 2009 Aug 29
Molecular Dynamics Analysis Of The Wild Type And dF508 Mutant Structures Of The Human CFTR-Nucleotide Binding Domain 1
Bisignano P and Moran O
Biochemie (2009) in press
BBA cover Structural organization of WrbA in apo- and holoprotein crystals
Wolfova J, Smatanova IK, Brynda J, Mesters JR, Lapkouski M, Kuty M, Natalello A, Chatterjee N, Chern SY, Ebbel E, Ricci A, Grandori R, Ettrich R, Carey J
Biochim Biophys Acta. 2009 Sep;1794(9):1288-98 Journal cover made with YASARA:
Structure cover Protein-peptide interactions adopt the same structural motifs as monomeric protein folds
Vanhee P, Stricher F, Baeten L, Verschueren E, Lenaerts T, Serrano L, Rousseau F, Schymkowitz J
Structure. 2009 Aug 12;17(8):1128-36 Journal cover made with YASARA:
Accurate prediction of DnaK-peptide binding via homology modelling and experimental data
Van Durme J, Maurer-Stroh S, Gallardo R, Wilkinson H, Rousseau F, Schymkowitz J
PLoS Comput Biol. 2009 Aug;5(8):e1000475
Structure of the tyrosine-sulfated C5a receptor N terminus in complex with chemotaxis inhibitory protein of Staphylococcus aureus
Ippel JH, de Haas CJ, Bunschoten A, van Strijp JA, Kruijtzer JA, Liskamp RM, Kemmink J
J Biol Chem. 2009 May 1;284(18):12363-72
Mapping the sequence mutations of the 2009 H1N1 influenza A virus neuraminidase relative to drug and antibody binding sites
Maurer-Stroh S, Ma J, Lee RT, Sirota FL, Eisenhaber F
Biol Direct. 2009 May 20;4(1):18
Protein sequences encode safeguards against aggregation
Reumers J, Maurer-Stroh S, Schymkowitz J, Rousseau F
Hum Mutat. 2009 Mar;30(3):431-7
A single residue influences the reaction mechanism of ammonia lyases and mutases
Bartsch S and Bornscheuer UT
Angew Chem Int Ed Engl. 2009;48(18):3362-5
Brominated phenols as auxin-like molecules
Spaepena S, Van Durme J, Dasa F, Maurer-Stroh S, Rousseau F, Schymkowitzb J and Vanderleydena J
Europ. J. of Soil Biol. 2009;45:81-87
Functional Role of Arginine 375 in Transmembrane Helix 6 of Multidrug Resistance Protein 4 (MRP4/ABCC4)
El-Sheikh AA, van den Heuvel JJ, Krieger E, Russel FG, Koenderink JB
Mol Pharmacol. 2008 Oct;74(4):964-71
Differential blocking effects of the acetaldehyde-derived DNA lesion N2-ethyl-2'-deoxyguanosine on transcription by multisubunit and single subunit RNA polymerases
Cheng TF, Hu X, Gnatt A, Brooks PJ
J Biol Chem. 2008 Oct 10;283(41):27820-8
Structural characterization of the alpha-hemolysin monomer from Staphylococcus aureus
Meesters C, Brack A, Hellmann N, Decker H
Proteins. 2008 Sep 17;75(1):118-126
The crystal structure of the platelet activator aggretin reveals a novel (alphabeta)2 dimeric structure
Hooley E, Papagrigoriou E, Navdaev A, Pandey AV, Clemetson JM, Clemetson KJ, Emsley J
Biochemistry. 2008 Jul 29;47(30):7831-7
A Software Library for Monte Carlo-Based Rigid Body Modelling Against Small Angle Scattering Data
Meesters C
From Computational Biophysics to Systems Biology (CBSB08) NIC Series, Vol. 40
Identification of surface epitopes of human coagulation factor Va which are important for interaction with activated protein C and heparin
Segers K, Dahlback B, Rosing J, Nicolaes GA
J Biol Chem. 2008 Jun 2
Complete inversion of enantioselectivity towards acetylated tertiary alcohols by a double mutant of a Bacillus subtilis esterase
Bartsch S, Kourist R, Bornscheuer UT
Angew Chem Int Ed Engl. 2008;47(8):1508-11
Cover Hepcidin: from discovery to differential diagnosis
Kemna EHJM, Tjalsma H, Willems HL, Swinkels DW
Haematologica, 93(1):90-97. Journal cover made with YASARA:
A three-dimensional model of mammalian tyrosinase active site accounting for loss of function mutations
Schweikardt T, Olivares C, Solano F, Jaenicke E, Garcia-Borron JC, Decker H
Pigment Cell Res. 2007 Oct;20(5):394-401
MYO15A (DFNB3) mutations in Turkish hearing loss families and functional modeling of a novel motor domain mutation
Kalay E, Uzumcu A, Krieger E, Caylan R, Uyguner O, Ulubil-Emiroglu M, Erdol H, Kayserili H, Hafiz G, Baserer N, Heister AJ, Hennies HC, Nurnberg P, Basaran S, Brunner HG, Cremers CW, Karaguzel A, Wollnik B, Kremer H
Am J Med Genet A. 2007 Oct 15;143(20):2382-9
Screening of the active site from water by the incoming ligand triggers catalysis and inhibition in serine proteases
Shokhen M, Khazanov N, Albeck A
Proteins. 2007 Oct 2
Similar enzyme activation and catalysis in hemocyanins and tyrosinases
Decker H, Schweikardt T, Nillius D, Salzbrunn U, Jaenicke E, Tuczek F
Gene. 2007 Aug 15;398(1-2):183-91
Clinical, structural and functional implications of mutations and polymorphisms in human NADPH P450 oxidoreductase
Fluck CE, Nicolo C, Pandey AV
Fundam Clin Pharmacol. 2007 Aug;21(4):399-410
The cytochrome P450 aromatase lacking exon 5 is associated with a phenotype of nonclassic aromatase deficiency and is also present in normal human steroidogenic tissues
Pepe CM, Saraco NI, Baquedano MS, Guercio G, Vaiani E, Marino R, Pandey AV, Fluck CE, Rivarola MA, Belgorosky A
Clin Endocrinol (Oxf). 2007 Jul 2
Amino acids in the second transmembrane helix of the Lhca4 subunit are important for formation of stable heterodimeric light-harvesting complex LHCI-730
Corbet D, Schweikardt T, Paulsen H, Schmid VH
J Mol Biol. 2007 Jun 29;370(1):170-82
Modulation of human cyp19a1 activity by mutant nadph p450 oxidoreductase
Pandey AV, Kempna P, Hofer G, Mullis PE, Fluck CE
Mol Endocrinol. 2007 Jun 26
MPP1 links the Usher protein network and the Crumbs protein complex in the retina
Gosens I, van Wijk E, Kersten FF, Krieger E, van der Zwaag B, Marker T, Letteboer SJ, Dusseljee S, Peters T, Spierenburg HA, Punte IM, Wolfrum U, Cremers FP, Kremer H, Roepman R
Hum Mol Genet. 2007 Jun 21
Structure of the dimeric N-glycosylated form of fungal beta-N-acetylhexosaminidase revealed by computer modeling, vibrational spectroscopy, and biochemical studies
Ettrich R, Kopecky V Jr, Hofbauerova K, Baumruk V, Novak P, Pompach P, Man P, Plihal O, Kuty M, Kulik N, Sklenar J, Ryslava H, Kren V, Bezouska K
BMC Struct Biol. 2007 May 17;7:32
PSA/KLK3 AREI promoter polymorphism alters androgen receptor binding and is associated with prostate cancer susceptibility
Lai J, Kedda MA, Hinze K, Smith RL, Yaxley J, Spurdle AB, Morris CP, Harris J, Clements JA
Carcinogenesis. 2006 Dec 13
Influence of modulated structural dynamics on the kinetics of alpha-chymotrypsin catalysis. Insights through chemical glycosylation, molecular dynamics and domain motion analysis
Sola RJ, Griebenow K
FEBS J. 2006 Dec;273(23):5303-19
The human Vps29 retromer component is a metallo-phosphoesterase for a cation-independent mannose 6-phosphate receptor substrate peptide
Damen E, Krieger E, Nielsen JE, Eygensteyn J, van Leeuwen JE
Biochem J. 2006 Sep 15;398(3):399-409
Structure-function analysis of the coxsackievirus protein 3A: identification of residues important for dimerization, viral RNA replication, and transport inhibition
Wessels E, Notebaart RA, Duijsings D, Lanke K, Vergeer B, Melchers WJ, van Kuppeveld FJ
J Biol Chem. 2006 281(38):28232-43
The first crystal structure of tyrosinase: all questions answered?
Decker H, Schweikardt T, Tuczek F
Angew Chem Int Ed Engl. 2006 Jul 10;45(28):4546-50
Arrestin interaction with rhodopsin: conceptual models
Modzelewska A, Filipek S, Palczewski K, Park PS
Cell Biochem Biophys. 2006;46(1):1-15
Structural models of the snake venom factor V activators from Daboia russelli and Daboia lebetina
Segers K, Rosing J, Nicolaes GA
Proteins. 2006 Sep 1;64(4):968-84
CoverGRIS: Glycoprotein-Hormone Receptor Information System.
Van Durme J, Horn F, Costagliola S, Vriend G , Vassart G
Mol Endocrinol. 2006 Sep;20(9):2247-55 Journal cover partly made with YASARA:
Completely buried, non-ion-paired glutamic acid contributes favorably to the conformational stability of pyrrolidone carboxyl peptidases from hyperthermophiles.
Kaushik JK, Iimura S, Ogasahara K, Yamagata Y , Segawa S, Yutani K
Biochemistry. 2006 Jun 13;45(23):7100-12.
Structure cover GTP-Ras Disrupts the Intramolecular Complex of C1 and RA Domains of Nore1.
Harjes E, Harjes S, Wohlgemuth S, Muller KH , Krieger E, Herrmann C, Bayer P.
Structure. 2006 May;14(5):881-8. Journal cover made with YASARA:
Fast empirical pK(a) prediction by Ewald summation.
Krieger E, Nielsen JE, Spronk CA, Vriend G .
J Mol Graph Model. 2006 Apr 25
The presence of multiple and differentially regulated interleukin-12p40 genes in bony fishes signifies an expansion of the vertebrate heterodimeric cytokine family.
Huising MO, van Schijndel JE, Kruiswijk CP, Nabuurs SB , Savelkoul HF, Flik G, Verburg-van Kemenade BM
Mol Immunol. 2006 Apr;43(10):1519-33
Repulsive separation of the cytoplasmic ends of transmembrane helices 3 and 6 is linked to receptor activation in a novel thyrotropin receptor mutant (M626I).
Ringkananont U, Van Durme J, Montanelli L , Ugrasbul F, Yu YM, Weiss RE, Refetoff S, Grasberger H .
Mol Endocrinol. 2006 Apr;20(4):893-903
ZNF674: A New Kruppel-Associated Box-Containing Zinc-Finger Gene Involved in Nonsyndromic X-Linked Mental Retardation.
Lugtenberg D, Yntema HG, Banning MJ, Oudakker AR , Firth HV, Willatt L, Raynaud M, Kleefstra T, Fryns JP , Ropers HH, Chelly J, Moraine C, Gecz J, Reeuwijk J , Nabuurs SB, de Vries BB, Hamel BC, de Brouwer AP, Bokhoven H
Am J Hum Genet. 2006 Feb;78(2):265-78
A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.
Kalay E, de Brouwer AP, Caylan R, Nabuurs SB , Wollnik B, Karaguzel A, Heister JG, Erdol H, Cremers FP , Cremers CW, Brunner HG, Kremer H.
J Mol Med. 2005 Dec;83(12):1025-32.
A novel GCAP1 missense mutation (L151F) in a large family with autosomal dominant cone-rod dystrophy (adCORD)
Sokal I, Dupps WJ, Grassi MA, Brown J Jr, Affatigato LM, Roychowdhury N, Yang L, Filipek S, Palczewski K, Stone EM, Baehr W
Invest Ophthalmol Vis Sci. 2005 Apr;46(4):1124-32
Interaction of nephrocystin-4 and RPGRIP1 is disrupted by nephronophthisis or Leber congenital amaurosis-associated mutations.
Roepman R, Letteboer SJ, Arts HH, van Beersum SE , Lu X, Krieger E, Ferreira PA, Cremers FP.
Proc Natl Acad Sci U S A. 2005 Dec 20;102(51):18520-5
A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.
Kalay E, de Brouwer AP, Caylan R, Nabuurs SB , Wollnik B, Karaguzel A, Heister JG, Erdol H, Cremers FP , Cremers CW, Brunner HG, Kremer H.
J Mol Med. 2005 Dec;83(12):1025-32
Definition of a new information-based per-residue quality parameter.
Nabuurs SB, Krieger E, Spronk CA, Nederveen AJ , Vriend G, Vuister GW.
J Biomol NMR. 2005 Oct;33(2):123-34.
Presence and absence of FSH receptor mutations provide some insights to spontaneous ovarian hyperstimulation syndrome physiopathology.
De Leener A, Montanelli L, Van Durme J, Chae H , Smits G, Vassart G, Costagliola S.
J Clin Endocrinol Metab. 2005 Nov 8;
JBC coverReconstruction of the Complete Ouabain-binding Pocket of Na,K-ATPase in Gastric H,K-ATPase by Substitution of Only Seven Amino Acids.
Qiu LY, Krieger E, Schaftenaar G, Swarts HG , Willems PH, De Pont JJ, Koenderink JB.
J Biol Chem. 2005 Sep 16;280(37):32349-55 Journal cover made with YASARA:
MPP5 recruits MPP4 to the CRB1 complex in photoreceptors.
Kantardzhieva A, Gosens I, Alexeeva S, Punte IM , Versteeg I, Krieger E, Neefjes-Mol CA, den Hollander AI , Letteboer SJ, Klooster J, Cremers FP, Roepman R, Wijnholds J .
Invest Ophthalmol Vis Sci. 2005 Jun;46(6):2192-201
Asn792 Participates in the Hydrogen Bond Network Around the K+-binding Pocket of Gastric H,K-ATPase.
Swarts HG, Koenderink JB, Willems PH, Krieger E, De Pont JJ.
J Biol Chem. 2005 Mar 25;280(12):11488-94
A Proline-Rich Region in the Coxsackievirus 3A Protein Is Required for the Protein To Inhibit Endoplasmic Reticulum-to-Golgi Transport.
Wessels E, Duijsings D, Notebaart RA, Melchers WJ, van Kuppeveld FJ.
J Virol. 2005 Apr;79(8):5163-73
Protein sequence randomization: efficient estimation of protein stability using knowledge-based potentials.
Wiederstein M, Sippl MJ.
J Mol Biol. 2005 Feb 4;345(5):1199-212
Validation of protein structures derived by NMR spectroscopy.
Spronk CA, Nabuurs SB, Krieger E, Vriend G, Vuister GW.
Progress in NMR spectroscopy. 2004 45:315-337.
Making optimal use of empirical energy functions: Force-field parameterization in crystal space.
Krieger E, Darden T, Nabuurs SB, Finkelstein A, Vriend G.
Proteins. 2004 57(4):678-683
Delineation of the discontinuous-conformational epitope of a monoclonal antibody displaying full in vitro and in vivo thyrotropin activity.
Costagliola S, Bonomi M, Morgenthaler NG, Van Durme J, Panneels V, Refetoff S, Vassart G.
Mol Endocrinol. 2004 18(12):3020-34 Journal cover made with YASARA:
OmpT: Molecular Dynamics Simulations of an Outer Membrane Enzyme.
Baaden M, Sansom MS.
Biophys J. 2004 87(5):2942-53
Identification of the MMRN1 binding region within the C2 domain of human factor V.
Jeimy SB, Woram RA, Fuller N, Quinn-Allen MA, Nicolaes GA, Dahlback B, Kane WH, Hayward CP.
J Biol Chem. 2004 279(49):51466-71
DRESS: a database of REfined solution NMR structures.
Nabuurs SB, Nederveen AJ, Vranken W, Doreleijers JF, Bonvin AM, Vuister GW, Vriend G, Spronk CA.
Proteins. 2004 55(3):483-6.
Identification and molecular modelling of a mutation in the motor head domain of myosin VIIA in a family with autosomal dominant hearing impairment (DFNA11).
Luijendijk MW, Van Wijk E, Bischoff AM, Krieger E, Huygen PL, Pennings RJ, Brunner HG, Cremers CW, Cremers FP, Kremer H.
Hum Genet. 2004 115(2):149-56.
A conformation-specific interhelical salt bridge in the K+ binding site of gastric H,K-ATPase.
Koenderink JB, Swarts HG, Willems PH, Krieger E, De Pont JJ.
J Biol Chem. 2004 279(16):16417-24.
A structural and dynamic model for the interaction of interleukin-8 and glycosaminoglycans: support from isothermal fluorescence titrations.
Krieger E, Geretti E, Brandner B, Goger B, Wells TN, Kungl AJ.
Proteins. 2004 54(4):768-75.
A mutation in the gamma actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26).
van Wijk E, Krieger E, Kemperman MH, De Leenheer EM, Huygen PL, Cremers CW, Cremers FP, Kremer H.
J Med Genet. 2003 40(12):879-84.
Fluorescence analysis of the Hansenula polymorpha peroxisomal targeting signal-1 receptor, Pex5p.
Boteva R, Koek A, Visser NV, Visser AJ, Krieger E, Zlateva T, Veenhuis M, van der Klei I.
Eur J Biochem. 2003 270(21):4332-8.
DJ-1( PARK7), a novel gene for autosomal recessive, early onset parkinsonism.
Bonifati V, Rizzu P, Squitieri F, Krieger E, Vanacore N, van Swieten JC, Brice A, van Duijn CM, Oostra B, Meco G, Heutink P.
Neurol Sci. 2003 24(3):159-60.
Quantitative Evaluation of Experimental NMR Restraints.
Nabuurs SB, Spronk CA, Krieger E, Maassen H, Vriend G, Vuister GW.
J Am Chem Soc. 2003 125(39):12026-12034.
The precision of NMR structure ensembles revisited.
Spronk CA, Nabuurs SB, Bonvin AM, Krieger E, Vuister GW, Vriend G.
J Biomol NMR. 2003 25(3):225-34.
Homology modeling.
Krieger E, Nabuurs SB, Vriend G.
Methods Biochem Anal. 2003;44:509-23.
Mutations in the DJ-1 gene associated with autosomal recessive early-onset parkinsonism.
Bonifati V, Rizzu P, van Baren MJ, Schaap O, Breedveld GJ, Krieger E, Dekker MC, Squitieri F, Ibanez P, Joosse M, van Dongen JW, Vanacore N, van Swieten JC, Brice A, Meco G, van Duijn CM, Oostra BA, Heutink P.
Science. 2003 299(5604):256-9
A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia.
van Swieten JC, Brusse E, de Graaf BM, Krieger E, van de Graaf R, de Koning I, Maat-Kievit A, Leegwater P, Dooijes D, Oostra BA, Heutink P.
Am J Hum Genet. 2003 72(4):1078.
Increasing the precision of comparative models with YASARA NOVA--a self-parameterizing force field.
Krieger E, Koraimann G, Vriend G.
Proteins. 2002 47(3):393-402.
Gain-of-function mutation in ADULT syndrome reveals the presence of a second transactivation domain in p63.
Duijf PH, Vanmolkot KR, Propping P, Friedl W, Krieger E, McKeon F, Dotsch V, Brunner HG, van Bokhoven H.
Hum Mol Genet. 2002 11(7):799-804.
Identification of different binding sites in the dendritic cell-specific receptor DC-SIGN for intercellular adhesion molecule 3 and HIV-1.
Geijtenbeek TB, van Duijnhoven GC, van Vliet SJ, Krieger E, Vriend G, Figdor CG, van Kooyk Y.
J Biol Chem. 2002 277(13):11314-20.
Models@Home: distributed computing in bioinformatics using a screensaver based approach.
Krieger E, Vriend G.
Bioinformatics. 2002 18(2):315-8.