Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Bond orders, hydrogens and pH dependency in YASARA

pH model

A chemical bond in YASARA has a certain order (single, double, etc.), but contrary to other modeling programs, fractional bond orders somewhere between 'single' and 'double' are also supported. This helps to conserve symmetries and provide a better picture of the underlying chemistry.

Bond orders as well as missing hydrogen atoms are assigned automatically for any organic molecule in a pH-dependent manner. After an initial typing pass developed in collaboration with the OpenBabel team, YASARA uses a library of SMILES strings to assign pKa values to functional groups, which then help to fine-tune bond orders and protonation patterns according to the chosen pH. This is the first step to fully automatic force field parameter assignment.

YASARA View is limited to pH 7, while YASARA Model allows to select any pH from 0 to 14 or work in vacuo. In YASARA Dynamics , you can also extend YASARA's chemical knowledge by adding your own SMILES strings to the library.

The whole concept is best illustrated with a few examples. The figure on the right shows seven small molecules at pH 0 to 14:

  • Column 1 - Phenol: All carbon-carbon bonds in the aromatic 6-ring are (roughly) equivalent, the bond order is 1.5 (colored red). From pH 10 on, the hydroxyl group loses the proton.

  • Column 2 - Acetic acid: From pH 0 to 4, the carboxyl group is neutral, one oxygen makes a double bond (yellow), the other one carries a hydrogen. From pH 5 on, the proton is gone and both oxygens are equivalent, making bonds of order 1.5 (red).

  • Column 3 - Imidazole ring: From pH 0 to 6, the ring is protonated, both nitrogens carry a hydrogen and make equivalent bonds of order 1.5 to the carbon in between. The nitrogen valence is thus 3.5, corresponding to a formal charge of +0.5 per nitrogen and +1 in total. From pH 7 on, the symmetry is broken, the molecule is neutral, and the nitrogen that does not carry a hydrogen makes a double bond instead.

  • Column 4 - Sulfuric acid: Below pH 2, the molecule is neutral, two oxygens make double bonds, the other two carry hydrogens. From pH 2 to 6, one hydrogen is gone, three oxygens are equivalent due to resonance effects, making bonds of order 1.66 (orange) each. The valence of the sulfur atom stays at 6 (1+3*1.66), and each of the three equivalent oxygens gets a formal charge of -0.33, summing up to -1. From pH 7 on, both hydrogens dissociate, all four oxygens make equivalent bonds of order 1.5 (red). The four resulting formal charges of -0.5 sum up to -2.

  • Column 5 - Guanidinium group: The side-chain of the amino acid arginine is a strong base due to resonance effects. From pH 0 to 12, the group is protonated, each nitrogen makes a bond of order 1.33 (magenta) to the central carbon. The carbon valence is thus normal (4), while each nitrogen has a valence of 3.33, the three resulting formal charges of +0.33 sum up to +1 in total. From pH 13 on, the symmetry is broken, one nitrogen loses a proton and makes a double bond.

  • Column 6 - Carbonic acid: Below pH 7, the molecule is neutral, one oxygen makes a double bond, the other two carry hydrogens. From pH 7 to 10, one hydrogen is gone, two oxygens are equivalent and make bonds of order 1.5 (red). From pH 11 on, both hydrogens dissociate, all three bonds are equivalent with order 1.33 (magenta). The three formal charges on the oxygens (-0.66) sum up to -2.

  • Column 7 - Phosphonic acid H3PO3: Similar to carbonic acid, just the phosphorous has a valence of 5 and therefore carries an additional hydrogen atom.