Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 

Virtual reality with YASARA in Linux and Windows

Since the very beginning, interactive molecular modeling has heavily benefited from a stereoscopic three-dimensional view, obtained mostly with the help of shutter glasses. While co-evolution with the video gaming industry brought 3D glasses for everyone during the 2010s, the shift to the more captivating virtual reality headsets has left modelers stranded without supply. Walking around and waving arms in a virtual world is great, but too tiring for hours of hard modeling work.

Since April 2023, YASARA combines the best of both worlds. Using a popular VR headset like Vive, Index, or Quest 2, the user sits in front of the normal screen, which is beamed into the virtual reality together with keyboard, mouse and chair using the headsetís cameras and an extra tracker attached to the seat-back. Compared to shutter glasses, this yields an equally relaxing, but much more immersive workplace, with the additional possibilities to take molecules into one's hands, stand up, and walk or teleport through the models.

Just watch the video on the right to get an overview and introduction to VR with YASARA. If you want to virtualize yourself, you need YASARA Model or a higher YASARA stage. Please see the detailed setup guide in the YASARA user manual, which lists the pros and cons of each headset supported. The easiest and cheapest way to get in touch with VR is the Meta Quest 2, while the best solution is the Vive Pro shown in the video, with an extra Vive tracker 3.0 to virtualize your chair. Since the Vive Pro is already in short supply, please act quickly.


Additional information:


R E F E R E N C E S

[1] Assembly of biomolecular gigastructures and visualization with the Vulkan graphics API
Ozvoldik K, Stockner T, Rammner B, and Krieger E (2021). Journal of Chemical Information and Modeling 61, 5293-5303


Virtual reality hi resolutionVirtual reality medium resolution
Figure 1: The video above shows how to get started with virtual reality in YASARA. It proves that the concept is so simple and user-friendly, that even 11-year old kids can work with it. If your browser fails to play the video, here is a YouTube link with worse quality.
Supported VR headsets
Figure 2: These are the VR headsets we bought and tested extensively in Linux and Windows. They are thus officially supported, other headsets may work with limitations or not at all.
VR overview
Figure 3: Overview of a VR setup with YASARA. Click the image for a larger version. Outside-in tracking with base stations (Vive, Index) and inside-out tracking without base stations (Quest 2) are both supported. Attaching a tracker to the chair to create a digital twin is currently only possible with outside-in tracking (Vive Tracker 3.0), but alternatives are in development.