Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

The YASARA Benchmarks

Since the first YASARA website went online in 1999, we have been providing benchmarks to allow an objective comparison with other programs. Our goal is however not to start 'benchmark wars' with other groups, as we are all trying to solve the same problems. So instead of comparing other programs with YASARA directly, we offer symbolic rewards of 100$ for the first one who can beat YASARA in one of the following benchmarks. (You do not have to use your own program, just anything you find).

The following restrictions apply:

  • All benchmarks were run on a Pentium IV, 1.8 GHz, 400MHz FSB,  512KB 2nd level cache, 512MB Rambus RAM, Geforce4 4400, Linux. Your program must be faster on the same or a slower PC.
  • Your program must be available, you must be able to reproduce your results.
  • Only the first one who wins a benchmark gets the money, then the benchmark will be removed.

Benchmark 1: 100$ for a more accurate force field

2A0B CrystalOn the left, you can see the unit cell of PDB entry 2A0B: the phosphotransfer domain of anaerobic sensor kinase ARCB, solved at 1.57 Å resolution. The cell contains four chains, and thanks to the high resolution, provides a very accurate view of protein structure. Running a molecular dynamics simulation of such a crystal moves the protein away from where it should be, due to inaccuracies in the force field. The smaller the damage, the more accurate the force field. During a 1 nanosecond simulation with YASARA's YAMBER2 force field, the maximum Calpha RMSD from the true structure is 0.70 Å. 100$ are yours if you manage to obtain a lower RMSD with any MD program / force field you like, under the condition that you did not optimize the force field specifically for 2A0B or its homologues.

Notes:
Hydrogens have been added with WHAT IF's H-bond network optimizer, counter ions and disordered water molecules were placed by YASARA. The cell size is 30.456 x 34.924 x 110.741 Å, you can download a PDB file here . Simulations must be run at the temperature of experimental structure determination (277K). Save snapshots in intervals of 5ps and calculate the average Calpha RMSD for all four chains. This average must stay below 0.70 Å in all 200 snapshots to win the benchmark.


Benchmark 2: 100$ for faster interactive molecular dynamics

Dihydrofolate ReductaseThe image on the right shows a simulation box containing dihydrofolate reductase (PDB entry 1AOE) and 6875 water molecules, summing up to 23788 atoms. On the 1.8 GHz Pentium IV described above, one integration step using the AMBER99 force field plus one update of the OpenGL graphics display take 0.8 seconds. 100$ are yours if you manage to do that faster.

Notes:
Choose the following simulation parameters: cutoff 7.86
Å, Particle Mesh Ewald electrostatics with a grid spacing of <0.97Å,4th order B-splines, tolerance level 1e-4.  If your program uses a pair-list, the setup time must be included. The cell size is 62x62x62 Å. Click here to download the PDB file . The protein must be displayed as a ribbon, the amino acid side-chains and the water molecules as sticks with at least the same visual quality.

Benchmark 3: 100$ for better molecular graphics

Ribosome, all atoms
Ribosome, zoomed in

The screenshots on the left show PDB entry 1N8R, the 50S ribosomal subunit with 98569 atoms, in space-filling mode. In the upper image, all atoms are on screen, YASARA delivers 6.6 frames per second (many programs are a factor 35 slower). On the lower image, we flew right through the ribosome to the backside, most atoms are now off-screen, resulting in 50 frames per second. To win the 100$, your program must be faster in both cases, while reaching at least the same visual quality (e.g. spheres must be equally round). This benchmark is run without antialiasing (switch it off in the Window menu).


Notes:
Resolution is 1024x768, color depth 16 bits, see above for more hardware details.