Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

The YASARA Benchmarks

Since the first YASARA website went online in 1999, we have been providing benchmarks to allow an objective comparison with other programs. Our goal is however not to start 'benchmark wars' with other groups, as we are all trying to solve the same problems. So instead of comparing other programs with YASARA directly, we offer symbolic rewards of 100$ for the first one who can beat YASARA in one of the following benchmarks. You do not have to use your own program, just any software you find.

DHFR BenchmarkAll benchmarks involve the enzyme dihydrofolate reductase (DHFR), which is commonly used for this purpose, a PDB file of the system with 23786 atoms can be downloaded here. The simulation is run with PME (grid spacing <1 A, 4th order B-splines), 8.0 A cutoff for Van der Waals and real-space Coulomb forces, correct atom masses, reproducible trajectory (running the simulation again gives the same results), Intel turbo boost disabled, and 8 AVX registers. More details about recommended CPUs and GPUs are available, the simulation algorithms are described in:

New ways to boost molecular dynamics simulations, Krieger E, Vriend G (2015) J.Comput.Chem. 36, with open access.

The following restrictions apply:

  • Benchmarks are shown for a certain CPU and graphics card. Your program must be faster on the same or slower hardware.
  • Your program must be available.
  • Only the first one who wins a benchmark gets the reward, then the benchmark will be removed.

Benchmark 1: 100$ or 1000$ for faster MD simulations on the CPU

On an Intel Core i7 5960X CPU running at 3.6 GHz (no turbo boost), without GPU, YASARA simulates DHFR with 160 ns/day, the computer costs around 1700 EUR. 100$ are yours if you can do it faster, or even 1000$ if you can do that with the same compiler options (GCC 4.8, -O3 -fno-strict-aliasing -march=core-avx2 -mavx2 -mfpmath=sse -ffast-math -m32). A YASARA power user reported 199 ns/day with the 5960X CPU clocked at 4.4 GHz.

Benchmark 2: 100$ for faster MD simulations on AMD Radeon GPUs

On an Intel Core i7 4770 CPU running at 3.4 GHz (no turbo boost), with an AMD Radeon R9-290X GPU, YASARA simulates DHFR with 150 ns/day, the computer costs around 1000 EUR. 100$ are yours if you can do it faster.

Benchmark 3: 100$ for faster MD simulations on nVIDIA GPUs with correct atom masses

On an Intel Core i7 5960X CPU running at 3.6 GHz (no turbo boost), with a Geforce GTX 980 GPU, YASARA simulates DHFR with 253 ns/day, the computer costs around 2300 EUR. For reasons explained here, YASARA uses the OpenCL industry standard to program the GPU. nVIDIA's OpenCL implementation is currently still lacking some functions that are available in its proprietary CUDA language, which gives CUDA-based programs an advantage, making it a very tight race. So to avoid a 100$ payment, we added the restriction that the simulation must be run with correct atom masses. A YASARA power user reported 290 ns/day with the 5960X CPU clocked at 4.4 GHz.

Benchmark 4: 100$ for faster interactive MD simulations

Interactive molecular modeling during a real-time molecular dynamics simulation allows you to pull individual atom and entire molecules around with the mouse or 3D input devices - or with your fingers on a touch-screen. As described in our open access articleYASARA View - molecular graphics for all devices - from smartphones to workstations, Krieger E, Vriend G (2014) Bioinformatics 30, 2981-2982,  this even works on smartphones, reaching 4 fps for an interactive DHFR simulation on a Motorola Razr i smartphone. 100$ are yours if you can do it faster.