Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Small molecule docking in YASARA

YASARA Structure provides everything you need to dock ligands with proteins at the touch of a button. Two different approaches are available now, a third one is planned for future release:

Approach 1: Autodock

AutoDockAutodock is a highly cited docking program developed at the Scripps Research Institute by Dr. Garrett M. Morris et al. [1]. YASARA Structure includes a tuned derivative of the original Autodock, which provides a number of advantages:

  • Docking at the touch of a button: select ligand, receptor and go.
  • Possibility to interactively place the simulation cell around the active site to focus docking on the most important region.
  • Possibility to interactively fix certain internal degrees of freedom of the ligand to perform anything from rigid to flexible docking.
  • Automatic typing of ligands, assignment of pH dependent bond orders and hydrogen atoms.
  • Semi-empirical QM calculations to assign high-quality RESP-like AutoSMILES charges, which are further tuned for maximum compatibility with the Autodock scoring function.
  • Automatic ligand structure analysis to determine the core fragment and its flexible attachments.
  • Parallel docking: make full use of today's multi core CPUs by docking on 16 cores in parallel.
  • Interruptible docking: run on your notebook, exit YASARA and continue docking next day.
  • Easy result analysis: concise docking report, all ligand conformers superposed and sorted by binding energy.

Approach 2: Fleksy

Flexy schemeFleksy is a brand-new program for flexible and induced fit docking developed at Organon Pharmaceuticals (now Schering-Plough) by Dr. Sander Nabuurs [2].

Pivotal to Fleksy is the use of a receptor ensemble to describe protein flexibility. To construct these ensembles, Fleksy uses YASARA's backbone-dependent rotamer library and implements the concept of interaction sampling. The latter allows the evaluation of different orientations of ambivalent interaction partners. The docking stage consists of an ensemble-based soft-docking experiment using FlexX-Ensemble, followed by an effective flexible receptor-ligand complex optimization using YASARA. Fleksy produces a set of receptor-ligand complexes ranked using a consensus scoring function combining docking scores and force field energies. Averaged over three cross-docking datasets, containing 35 different receptor-ligand complexes in total, Fleksy reproduces the observed binding mode within 2.0 A for 78% of the complexes.

Fleksy builds on functions provided by YASARA Structure and FlexX (so you need these two programs) and is distributed and supported directly by Dr. Nabuurs, please contact him here .

Approach 3: YASARA Dock

YASARA's own docking module is currently under development, any news will be posted here.


R E F E R E N C E S

[1] Automated Docking Using a Lamarckian Genetic Algorithm and and Empirical Binding Free Energy Function
Morris GM, Goodsell DS, Halliday RS, Huey R, Hart WE, Belew RK and Olson AJ (1998), J.Comput.Chem. 19,1639-1662
[2]
A flexible approach to induced fit docking
Nabuurs SB, Wagener M and de Vlieg J (2007), Journal of Medicinal Chemistry 50, 6507-6518