Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Macros

Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.

° 

Molecular dynamics

° 

Running a steered molecular dynamics simulation in water

This macro sets up and runs a steered simulation to pull a ligand from its binding site.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/02/23

° 

Refining a homology model by molecular dynamics simulation in water

This macro runs a 500 ps simulation of a homology model using the protocol described in Proteins 57,678-683. It saves one PDB file every 25 picoseconds, including a table with force field energies to identify the best snapshot. If you have the Twinset installed, this table also contains PhiPsi, Backbone and Packing3 checks.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/02/23

Download: md_refine.mcr

° 

Running an accurate molecular dynamics simulation in water

This macro sets up and runs a simulation. It can also continue a simulation that got interrupted.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/02/23

Download: md_run.mcr

° 

Analyzing a molecular dynamics trajectory of multiple objects

This macro analyzes a simulation and creates a table with energies and RMSDs from the starting structures for multiple objects

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/02/14

° 

Analyzing a molecular dynamics trajectory

This macro analyzes a simulation and creates a table with energies and RMSDs from the starting structure, as well as the time average structure with B-factors calculated from the root mean square fluctuations.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/02/14

Download: md_analyze.mcr

° 

Analyzing the change of secondary structure in a molecular dynamics trajectory

This macro analyzes a simulation and creates a table with per-residue secondary structure as well as a graphical plot

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/01/31

° 

Analyzing a molecular dynamics trajectory per residue

This macro analyzes a simulation and creates a table with average RMSFs and RMSDs from the starting structure per residue

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/01/31

° 

Play back a molecular dynamics trajectory

This macro plays back a molecular dynamics simulation, looping back to the start.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/01/31

Download: md_play.mcr

° 

Convert between SIM and XTC simulation trajectories

This macro converts an existing MD trajectory from SIM to XTC format and vice versa

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2006/10/30

Download: md_convert.mcr

° 

Structure determination

° 

Refine an NMR ensemble in explicit solvent

This macro refines an NMR ensemble in explicit solvent to increase the accuracy

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2008/02/23

° 

Set default parameters for NMR structure determination

This macro is included by others to set default parameters

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2008/02/16

° 

Refine an NMR ensemble in vacuo

This macro refines a roughly folded structure in vacuo to create a realistic fold

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2008/02/16

° 

Analyze and merge an NMR ensemble

This macro analyzes an NMR ensemble and merges the members into a single PDB file

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2008/02/16

Download: nmr_analyze.mcr

° 

Solve an NMR structure with fixed quality

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format. Contrary to the normal nmr_solve macro, it refines only those structures in water, that match a quality criterion, and performs an unlimited number of folding runs until the ensemble has the requested size

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2006/12/21

° 

Solve an NMR structure

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2006/12/21

Download: nmr_solve.mcr

° 

Fold an ensemble of NMR structures

This macro folds a structure from the stretched-out conformation using NMR restraints

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2006/12/21

Download: nmr_fold.mcr

° 

Structure prediction

° 

Docking a ligand to a receptor

This macro predicts the structure of a ligand-receptor complex. It can also continue a docking run that got interrupted. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/02/23

Download: dock_run.mcr

° 

Docking a ligand to a receptor locally

This macro samples local ligand conformations in a user-supplied complex. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/02/14

° 

Showing the docking results interactively

This macro cycles through the results of the various docking runs, and then shows the best complex in each cluster

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/11/25

Download: dock_play.mcr