Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Molecular graphics

° 

Movies

To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). MacOSX tries to hide the yasara directory from you: open Finder, browse to the YASARA application and click on 'Show package contents' in the context menu to see the yasara directory.

If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros, that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.

° 

Surfaces III - Electrostatics

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2009/01/13

° 

Cut-planes

Figure: A snapshot from the movie
A tutorial about using cut-planes to look inside surfaces and other polygon meshes

Written by: Elmar Krieger & Sven Geier

License: GNU GPL

Last modified: 2009/01/13

° 

Surfaces I - Introduction

Figure: A snapshot from the movie
An introduction to the different kinds of surfaces. Many thanks to Sven Geier for his 'Speed' background (more at http://www.its.caltech.edu/~sgeier/).

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/11/26

° 

The Basics

Figure: A snapshot from the movie
A tutorial explaining how to use YASARA to create ray-traced molecular graphics. Many thanks to Sven Geier for his 'Opalshards' background (more at http://www.its.caltech.edu/~sgeier/).

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/11/24

° 

Lighting and shadows

Figure: A snapshot from the movie
An introduction to lighting and shadows in YASARA. Many thanks to Sven Geier for his marvellous 'Thetaspace' background (more at http://www.its.caltech.edu/~sgeier/)

Written by: Elmar Krieger & Sven Geier

License: GNU GPL

Last modified: 2008/07/11

° 

Surfaces II - Environments

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/07/11

° 

Plugins

Plugins are Python scripts or Yanaconda macros that extend YASARA's user interface and get activated when you click the respective option. They are the method of choice to extend YASARA with your own functions.

All plugins are distributed together with YASARA and should be available from the graphical user interface. Windows users need to have Python from www.python.org installed.

To reinstall a plugin, just download the ZIP file and unpack it in the yasara/plg directory. If you then restart YASARA, the new options will appear in the menus. If you are not sure where the option appears, look at the top of the main plugin file (*.mcr or *.py).

° 

GIF/MPEG Movie Clip Encoder

This plugin creates an MPEG movie or animated GIF of the rotating scene, click File > Save as > Animated GIF.

Written by: Emmanuel Bettler & Ahmet Sacan

License: GNU GPL

Last modified: 2009/05/20

° 

ConSurf coloring

This plugin colors the residues in the selected molecules by conservation scores assigned by the ConSurf webserver at consurf.tau.ac.il. If the object name is a valid PDB ID, the plugin will download the preassigned conservation scores, caching them for quick reuse later. If the object name is not a valid PDB ID, the plugin assumes that this is a private structure which you submitted manually to the server before, so that the B-factors already represent the conservation scores and coloring can start immediately. Coloring can be done in two ways. First by conservation gradient only: cyan is variable, gray is average and purple is conserved. Second by amino acid property and conservation blended together: polars are green, hydrophobics are yellow, negatives are red and positives are blue. Darker colors mean higher conservation, lighter colours mean lower conservation. With the second color option, two thresholds can be given for assigning high and low conservation. Defaults are 80% for upper and 60% for lower threshold. E.g. with an upper threshold of 80%, this means that all residues with a conservation score higher than 80% of the maximum conservation score are considered highly conserved. If the lower threshold is 60%, residues with a score between 60% of max and 80% of max are considered no so conserved. All other residues below the lower threshold are coloured in gray (means variable).

Written by: Joost Van Durme & Sebastian Maurer-Stroh. SWITCH Lab, VIB, Brussels, Belgium

License: GPL (www.gnu.org)

Last modified: 2009/05/11