CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

YASARA Energy Minimization Server

This server performs an energy minimization using the YASARA force field. Simply enter your email address, upload your protein model in PDB format and click the 'Submit' button. Note that results will be placed in a public download area, therefore do not submit confidential data. You can also use this functionality and much more on your own computer. It is part of YASARA Structure.

If you use the results of this server, please cite the following article:

Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8
Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K
Proteins. 2009;77 Suppl 9:114-22

YASARA Minimization Server

Either PDB ID..
..or any other PDB file:

  • If you want to submit multiple structures, please wait until you received the confirmation email before submitting the next structure. Then you can sort the results based on the growing number in the download path and retrieve them in the proper order.
  • If you don't get a confirmation email after submission, please check your spam folder and then wait 24 hours before reporting a problem, sometimes it takes longer.
  • If you want to submit tons of structures, please seriously consider buying your own YASARA Structure license and doing this on your own computer. If this is impossible, then implement a script that submits at most three structures at once (and then waits for results before submitting more, otherwise you block the server for other users).