Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)
 

YASARA Energy Minimization Server

This server performs an energy minimization using the YASARA force field. Simply enter your email address, upload your protein model in PDB format and click the 'Submit' button. Note that results will be placed in a public download area, therefore do not submit confidential data. You can also use this functionality and much more on your own computer. It is part of YASARA Structure.

If you use the results of this server, please cite the following article:

Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8
Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K
Proteins. 2009;77 Suppl 9:114-22

YASARA Minimization Server

Either PDB ID..
..or any other PDB file:

  • If you want to submit multiple structures, please wait until you received the confirmation email before submitting the next structure. Then you can sort the results based on the growing number in the download path and retrieve them in the proper order. You get the best performance if you not only wait for the confirmation, but for the actual result before submitting the next job. The reason is that all jobs you submit while another job of yours is in the pipeline get reduced priority and have to wait until no more 'first submissions' are in the queue.
  • Since this server is a free service, it is not our goal to make it "super convenient" like the YASARA application itself. Please don't be annoyed that you have to download the free YASARA View to open the results and convert them to your favorite format. You are very welcome to boost YASARA development by obtaining YASARA Structure and running the minimization on your own computer, with personal support in case something does not work as expected.
  • If you don't get a confirmation email after submission, please check your spam folder and then wait 48 hours before reporting a problem, sometimes it takes longer.
  • Here is a short description of the minimization protocol (for more details and references check the documentation of free YASARA View at the commands listed in parentheses): The server starts with about 40 different cleanup operations that prepare the structure for simulation ('Clean' command), predicts the best amino-acid side-chain rotamers with the SCWRL algorithm and then uses the YASARA2 force field ('ForceField' command) with implicit solvent ('SolvEnergy' command) to tune the rotamers with a steepest-descent minimization in dihedral angle space ('OptimizeRes' command). Afterwards the hydrogen-bonding network is optimized ('OptHyd' command) and the solute is embedded in an explicit solvent shell 6 A thick, side-chain pKas are predicted and protonation states fine-tuned for pH 7.4 ('Experiment Neutralization' command). Then a steepest descent minimization to remove remaining clashes is performed, followed by a simulated annealing minimization with atom velocities scaled down by 0.9 every ten steps to reach a stable nearby energy minimum (this is not a global search, see 'Experiment Minimization' command). During the minimization, cis-peptide bonds and wrong side-chain isomers are corrected. The minimization stops as soon as the energy improves by less than 0.05 kJ/mol per atom during 200 steps. The energies shown are the sum of force field energy (excluding water) and implicit solvation energy (fast boundary element method, 'SolvEnergy' command). The quality Z-scores shown are the average of the 'Dihedrals', 'Packing1D' and 'Packing3D' scores ('Check' command).