Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Molecular modeling

° 

Movies

To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). MacOSX tries to hide the yasara directory from you: open Finder, browse to the YASARA application and click on 'Show package contents' in the context menu to see the yasara directory.

If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros, that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.

° 

Building small molecules

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL, except stellar nebula (copyright by Jaime Vives Piqueres)

Last modified: 2012/04/01

° 

Knowledge-based potentials

Figure: A snapshot from the movie
An overview of knowledge-based potentials. What they are, how to visualize them and how to use them.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Electrostatic potentials

Figure: A snapshot from the movie
A tutorial covering the different ways of representing electrostatic potentials using Particle Mesh Ewald and Poisson-Boltzmann methods

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Domain replacement

Figure: A snapshot from the movie
A tutorial explaining how to replace a loop or an entire domain, for example to create a hybrid template for homology modeling. Many thanks to Sven Geier for his 'Hidden' background (more at www.sgeier.net/fractals).

Written by: Ahmet Sacan

License: GNU GPL

Last modified: 2012/04/01

° 

Plugins

Plugins are Python scripts or Yanaconda macros that extend YASARA's user interface and get activated when you click the respective option. They are the method of choice to extend YASARA with your own functions.

All plugins are distributed together with YASARA and should be available from the graphical user interface. Windows users need to have Python from www.python.org installed.

To reinstall a plugin, just download the ZIP file and unpack it in the yasara/plg directory. If you then restart YASARA, the new options will appear in the menus. If you are not sure where the option appears, look at the top of the main plugin file (*.mcr or *.py).

° 

FoldX forcefield plugin

This plugin provides access to various tools from the FoldX molecular modeling and design program in YASARA. FoldX can be obtained from http://foldx.crg.es. Plugin updates and documentation are provided at http://foldxyasara.switchlab.org. Especially for academics, commercial users need a FoldX license.

Written by: Joost Van Durme. VIB Switch Laboratory, Brussels, Belgium

License: GPL (www.gnu.org)

Last modified: 2012/04/01

° 

Align3D

This plugin performs a structural alignment with the help of various programs or web servers: Sheba by J.Jung & B.Lee, which is downloaded automatically from http://rex.nci.nih.gov/RESEARCH/basic/lmb/mms/sheba.htm in Linux, Multiprot by Shatsky, Nussinov & Wolfson and CE by Shindyalov & Bourne. YASARA Plugin developed at the IBCP France, see http://pbil.ibcp.fr/~ebettler/stages/mroche/. Click Analyze > Align.

Written by: Mikael Roche & Emmanuel Bettler

License: GNU GPL

Last modified: 2011/11/02

° 

Interactive oligosaccharide builder

This plugin performs interactive building of oligosaccharides

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/01/07

° 

Macros

Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.

° 

Running an energy minimization

This macro runs an energy minimization of the soup. Compared to the normal minimization experiment, it temporarily adds a water shell so that all force fields can be used directly, also those optimized for use with explicit solvent

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

Download: em_run.mcr