Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


Mail Order / Quotation Request


YASARA Model is too large for download and will be delivered to you on CD including a bill, that is why we have to ask for your full address.
Note that you can also use the form below to request a quotation without placing an order.
If you plan to order YASARA for multiple users/group leaders or more than one year of support, visit the license fee page for detailed pricing information.


Please customize your personal edition of
YASARA Model

Your operating system:
Your processor:
If you know your processor, downloads will be smaller.
Type of usage:
Number of licenses:
Use '1' above for one single license or one group leader license. For more information about multiuser licenses including prices click here.
License period in years:
To read about the benefits of ordering more than one year click here.
Please use only plain English characters in the fields below.
Your first name:
Your Middle initials:
Your family name:
Department,Room:
University/Company:
Street,Number:
ZIP(Postcode):
City,State:
Country:
Your email address:
Please doublecheck the email address, it is essential for downloads, updates and support.
What shall we do?




YASARA is linked with the Simple Direct Media Layer library which is released under the GNU LPGL. Click here for LGPL compliance information .