Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Movies

To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). MacOSX tries to hide the yasara directory from you: open Finder, browse to the YASARA application and click on 'Show package contents' in the context menu to see the yasara directory.

If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros, that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.

° 

General

° 

Working with YASARA

Figure: A snapshot from the movie
A tutorial explaining how to work with YASARA to new users. Many thanks to Sven Geier for his 'Planetary' background (more at www.sgeier.net/fractals).

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/03/25

° 

Working with the Twinset

Figure: A snapshot from the movie
An introduction to using WHAT IF from within YASARA. Many thanks to Sven Geier for his 'Sigmaspace' background (more at http://www.its.caltech.edu/~sgeier/).

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/01/27

° 

What's new in YASARA Structure

Figure: A snapshot from the movie
An overview of the new features in YASARA Structure

Written by: Elmar Krieger & James Magahern

License: GNU GPL

Last modified: 2012/04/01

° 

Calibrating and using the P5 data glove

Figure: A snapshot from the movie
This tutorial allows you to calibrate the P5 data glove available from www.EssentialReality.com. Usage instructions are also included.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/07/11

° 

Molecular graphics

° 

The Basics

Figure: A snapshot from the movie
A tutorial explaining how to use YASARA to create ray-traced molecular graphics. Many thanks to Sven Geier for his 'Opalshards' background (more at http://www.its.caltech.edu/~sgeier/).

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2013/01/27

° 

Surfaces II - Environments

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/06/03

° 

Surfaces III - Electrostatics

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Surfaces I - Introduction

Figure: A snapshot from the movie
An introduction to the different kinds of surfaces. Many thanks to Sven Geier for his 'Speed' background (more at http://www.its.caltech.edu/~sgeier/).

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Lighting and shadows

Figure: A snapshot from the movie
An introduction to lighting and shadows in YASARA. Many thanks to Sven Geier for his 'Thetaspace' background (more at http://www.its.caltech.edu/~sgeier/).

Written by: Elmar Krieger & Sven Geier

License: GNU GPL

Last modified: 2012/04/01

° 

Advanced GPU effects

Figure: A snapshot from the movie
A demonstration of the features of YASARA's new GPU shader-based graphics engine

Written by: Elmar Krieger and Jacobus van Meel

License: GNU GPL

Last modified: 2012/04/01

° 

Cut-planes

Figure: A snapshot from the movie
A tutorial about using cut-planes to look inside surfaces and other polygon meshes

Written by: Elmar Krieger & Sven Geier

License: GNU GPL

Last modified: 2012/04/01

° 

Molecular dynamics

° 

The YAMBER force field, ICMSB 2003

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Simulation and quantum mechanics of small molecules

Figure: A snapshot from the movie
This tutorial introduces fractional bond orders and pH dependency, shows how to build and simulate small molecules, and how to use quantum mechanics to optimize geometries and compare tautomers.

Written by: Elmar Krieger

License: GNU GPL, except coral reef background by Ove Hoegh-Guldberg (Centre for Marine Studies, University of Queensland)

Last modified: 2012/04/01

° 

Accurate simulations in water

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

The theory behind molecular dynamics simulations

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Interactive simulations for modeling

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Molecular modeling

° 

Domain replacement

Figure: A snapshot from the movie
A tutorial explaining how to replace a loop or an entire domain, for example to create a hybrid template for homology modeling. Many thanks to Sven Geier for his 'Hidden' background (more at www.sgeier.net/fractals).

Written by: Ahmet Sacan

License: GNU GPL

Last modified: 2012/08/26

° 

Knowledge-based potentials

Figure: A snapshot from the movie
An overview of knowledge-based potentials. What they are, how to visualize them and how to use them.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/06/03

° 

Building small molecules

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL, except stellar nebula (copyright by Jaime Vives Piqueres)

Last modified: 2012/04/01

° 

Electrostatic potentials

Figure: A snapshot from the movie
A tutorial covering the different ways of representing electrostatic potentials using Particle Mesh Ewald and Poisson-Boltzmann methods

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Research topics

° 

PhD Thesis Defence 2004/09/27 by Elmar Krieger

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/05/14

° 

CASP8 meeting on Sardinia 2008/12/04

Figure: A snapshot from the movie
A summary of the protein structure prediction tricks used by YASARA during CASP8.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/12/15

° 

Methionine Synthase

Figure: A snapshot from the movie
An overview of the catalytic activity of methionine synthase

Written by: Richard Deth & Elmar Krieger

License: GNU GPL

Last modified: 2008/11/03

° 

PhD Thesis Defence 2006/02/09 by Sander Nabuurs

Figure: A snapshot from the movie
Written by: Sander Nabuurs

License: GNU GPL

Last modified: 2008/07/11

° 

Multimedia

° 

Triple8 Celebration

Figure: A snapshot from the movie
A video game written in Yanaconda to celebrate the release of YASARA Structure and two anniversaries

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

Buckynut Island

Figure: A snapshot from the movie
A video game written in Yanaconda to demonstrate the use of solids. Help Yami collect the Buckminster nuts. (Current highscore is 215 points by Bas Vroling)

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/04/01

° 

The crazy pig animation

Figure: A snapshot from the movie
This is an example for multimedia animations, in honour of the Pink Pig (www.pinkpigpage.com).

Written by: Emmanuel 'CrazyPig' Bettler

License: Images copyright by pinkpigpage.com

Last modified: 2009/05/02

° 

The protein structure group at the CMBI

Figure: A snapshot from the movie
An introduction to the 'Vriend Group' at the CMBI, can be easily adapted to introduce your own research group

Written by: Elmar Krieger

License: GNU GPL, Grass texture by Rune S. Johansen

Last modified: 2008/11/02