Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Multimedia

° 

Movies

To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). MacOS tries to hide the yasara directory from you: open Finder, browse to the YASARA application and click on 'Show package contents' in the context menu to see the yasara directory.

If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.

° 

Buckynut Island

Figure: A snapshot from the movie
A video game written in Yanaconda to demonstrate the use of solids. Help Yami collect the Buckminster nuts. (Current highscore is 215 points by Bas Vroling)

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2020/06/03

Download: buckynut.zip

° 

The protein structure group at the CMBI

Figure: A snapshot from the movie
An introduction to the 'Vriend Group' at the CMBI, can be easily adapted to introduce your own research group

Written by: Elmar Krieger

License: GNU GPL, Grass texture by Rune S. Johansen

Last modified: 2020/05/23

Download: cmbi.zip

° 

Triple8 Celebration

Figure: A snapshot from the movie
A video game written in Yanaconda to celebrate the release of YASARA Structure and two anniversaries

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2020/05/20

Download: triple8.zip

° 

The crazy pig animation

Figure: A snapshot from the movie
This is an example for multimedia animations, in honour of the Pink Pig (www.pinkpigpage.com).

Written by: Emmanuel 'CrazyPig' Bettler

License: Images copyright by pinkpigpage.com

Last modified: 2016/04/24

Download: crazypig.zip

° 

Plugins

Plugins are Python scripts or Yanaconda macros that extend YASARA's user interface and get activated when you click the respective option. They are the method of choice to extend YASARA with your own functions.

All plugins are distributed together with YASARA and should be available from the graphical user interface. Windows users need to have Python from www.python.org installed.

To reinstall a plugin, just download the ZIP file and unpack it in the yasara/plg directory. If you then restart YASARA, the new options will appear in the menus. If you are not sure where the option appears, look at the top of the main plugin file (*.mcr or *.py).

° 

OpenOffice/LibreOffice Import Filter

This plugin imports an OpenOffice/LibreOffice Impress Presentation and converts it to a YASARA movie. Click Options > Macro & Movie > Import movie.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2017/11/22

Download: openoffice.zip