Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA related links

If you are working with YASARA yourself and have a website to show, please add it here.

Bio-Prodict - Developer of 3DM, a tool that can automatically generate super-family specific databases designed to guide scientific research in the field of protein engineering, drug design and DNA-diagnostics, and employs YASARA as an interactive database interface.

FoldX plugin - A YASARA interface to FoldX free energy predictions by Joost van Durme.

Spronk NMR Consultancy - A company that makes heavy use of YASARA for NMR related scientific development and consulting services.

GRIS - Glycoprotein-hormone Receptor Information System. YASARA is used to optimize homology models and generate high quality images online.

Align3D - A YASARA plugin for structural alignments using Sheba, FlexProt, MultiProt and SSM, developed at IBCP, Pole Bioinformatique Lyonnais, France

DRESS - A subset of the NMR structures deposited in the PDB, consistently refined in explicit solvent to obtain more realisitic results. Uses YASARA for structure conversions.

QUEEN - Working with NMR spectroscopy? Want to identify important NOEs and those that may have been misassigned? Then visit the QUEEN.

MCSIS - Molecular Class Specific Information System.

Click here to add your own site.

Other resources


Links for Chemists - the Chemistry section of the WWW Virtual Library.

Bio-Computing.org - covers recent literature, tutorials, a bioinformatics lab registry, links, bioinformatics database, jobs, and news.

Click here to add your own site.