Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA related links

If you are working with YASARA yourself and have a website to show, please add it here.

CMBI course by Joules KerssemakersCMBI - The Center for Molecular and Biomolecular Informatics at the Radboud University Nijmegen, the Netherlands, is our main academic partner. It hosts the YASARA download servers and makes extensive use of YASARA for research and teaching (image on the right courtesy of Bart van Dieken ), often combined in the Twinset with the CMBI's inhouse software WHAT IF .

Bio-Prodict - Developer of 3DM, a tool that can automatically generate super-family specific databases designed to guide scientific research in the field of protein engineering, drug design and DNA-diagnostics, and employs YASARA as an interactive database interface.

FoldX plugin - A YASARA interface to FoldX free energy predictions by Joost van Durme.

Spronk NMR Consultancy - A company that makes heavy use of YASARA for NMR related scientific development and consulting services.

GRIS - Glycoprotein-hormone Receptor Information System. YASARA is used to optimize homology models and generate high quality images online.

Align3D - A YASARA plugin for structural alignments using Sheba, FlexProt, MultiProt and SSM, developed at IBCP, Pole Bioinformatique Lyonnais, France

DRESS - A subset of the NMR structures deposited in the PDB, consistently refined in explicit solvent to obtain more realisitic results. Uses YASARA for structure conversions.

QUEEN - Working with NMR spectroscopy? Want to identify important NOEs and those that may have been misassigned? Then visit the QUEEN.

MCSIS - Molecular Class Specific Information System.

Click here to add your own site.

Other resources


Links for Chemists - the Chemistry section of the WWW Virtual Library.

Bio-Computing.org - covers recent literature, tutorials, a bioinformatics lab registry, links, bioinformatics database, jobs, and news.

Click here to add your own site.