Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


License Upgrade

If you want to make a change to your current license, please post your request below. Typical changes are upgrades from YASARA Model to Dynamics, from academic to commercial usage, or from a single to a group leader license. If you want to change from YASARA View to Model or Dynamics, please use the order forms instead.

If you are not sure about the cost of the upgrade, use the License Fee Calculator . Your YASARA account will be charged with the difference between this price and the current value of your existing YASARA license. Feel free to request more details using the form below.


Upgrade information

Your email address:
The email address must be the same as in your initial YASARA registration.
What do you want to change?