Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Why YASARA?

Back in 1966, Cyrus Levinthal (known even to first-year biochemistry students thanks to the "Levinthal Paradox" of protein folding) published a clairvoyant article in Scientific American (fig.3) that marks the official beginning of molecular graphics and interactive modeling. Having pointed out the importance of true interaction between the user and the program during modeling ("..it is our experience that an investigator, who is looking at a molecule can frequently understand the reason for a local minimum and by making a small alteration in the structure can return the program to its downhill path. "), he concluded that by adding pseudo-energy terms to the molecular dynamics force field, we can "..do the same pulling and pushing in the computer that we can do with our hands while building actual models. "

Nevertheless, his ideas have not really made it into todays modeling and molecular dynamics programs. If you want to know if an Aspartate and a Lysine on the protein surface can form a salt-bridge, you are still often asked to change torsion angles - would it not be far more comfortable to simply pull them together and see if they stay there, if the new conformation is thus stable?

This approach - called "interactive real-time molecular dynamics" - forms the basis on which YASARA is built. True user interaction is always possible, you can move atoms or entire molecules around using sophisticated input devices while watching the whole scene in 3D with shutter glasses or a stereoscopic TFT screen .

If it is useful - then why do not all modeling programs allow you to do that? The reason is simple: displaying a large protein including surrounding water molecules while running a molecular dynamics simulation - that is still at the edge of what is possible on a single PC today, even with a 3.2 GHz CPU. YASARA therefore makes extensive use of PVL (Portable Vector Language), a new approach to portable high performance computing. PVL allows us to guarantee highest performance and accuracy. Check the benchmark page for details.

Click for larger image
Fig.1: The official start of molecular graphics - back in 1966 at the M.I.T. More details can be found at the Max-Planck Institute for the History of Science .
Click for larger image
Fig.2: The first YASARA workstation in 1997: Pentium 133, shutter glasses, ultrasonic pointer, virtual reality helmet and force feedback joystick with six degrees of freedom.
Click for larger image
Fig.3: Cyrus Levinthal's clairvoyant article from 1966 - most of it is even more valid today than back in these early times of molecular modeling.